Incidental Mutation 'R8078:Cadm3'
ID629117
Institutional Source Beutler Lab
Gene Symbol Cadm3
Ensembl Gene ENSMUSG00000005338
Gene Namecell adhesion molecule 3
SynonymsSynCAM3, Tsll1, Igsf4b, BIgR, Necl-1, Necl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R8078 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173333258-173367695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173341059 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 314 (V314A)
Ref Sequence ENSEMBL: ENSMUSP00000106851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005470] [ENSMUST00000111220]
Predicted Effect probably damaging
Transcript: ENSMUST00000005470
AA Change: V348A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005470
Gene: ENSMUSG00000005338
AA Change: V348A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 67 159 1.43e-8 SMART
IG 169 262 6.31e-1 SMART
IGc2 277 338 3.91e-6 SMART
low complexity region 351 359 N/A INTRINSIC
4.1m 383 401 9.24e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111220
AA Change: V314A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106851
Gene: ENSMUSG00000005338
AA Change: V314A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
IG 33 125 1.43e-8 SMART
IG 135 228 6.31e-1 SMART
IGc2 243 304 3.91e-6 SMART
low complexity region 317 325 N/A INTRINSIC
4.1m 349 367 9.24e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-independent cell-cell adhesion protein that can form homodimers or heterodimers with other nectin proteins. The encoded protein has both homophilic and heterophilic cell-cell adhesion activity. This gene is reported to be a tumor suppressor gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed myelination. Other mice with ubiquitous conditional deletion of the gene do not display neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,301,279 V2884I probably benign Het
Actl10 T A 2: 154,552,570 N147K probably benign Het
Agpat2 C A 2: 26,604,101 C37F possibly damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd26 T A 6: 118,517,893 probably null Het
Bcas1 T C 2: 170,418,612 E49G possibly damaging Het
Birc3 A G 9: 7,858,741 V331A probably damaging Het
Cep290 T C 10: 100,572,887 V2407A probably benign Het
Chd5 C A 4: 152,360,991 N446K possibly damaging Het
Clec9a A G 6: 129,409,033 S27G probably benign Het
Coro1c G T 5: 113,882,103 A17E probably damaging Het
Cspg4 T C 9: 56,890,259 S1336P possibly damaging Het
Ddx55 G A 5: 124,566,388 V353M probably damaging Het
Farp1 T A 14: 121,276,300 S836T probably benign Het
Fbll1 G T 11: 35,797,901 D178E probably benign Het
Flg2 T G 3: 93,200,275 D22E probably damaging Het
Glis1 T A 4: 107,567,902 C237S probably damaging Het
Gm5519 T C 19: 33,822,957 V17A possibly damaging Het
Gucy2c C A 6: 136,697,921 G1055C probably damaging Het
Hspg2 T C 4: 137,508,022 Y123H probably damaging Het
Idh1 T A 1: 65,161,066 I380F probably damaging Het
Il23r A T 6: 67,423,593 N584K probably damaging Het
Lama1 A T 17: 67,791,294 T1829S Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Luzp2 T A 7: 55,052,762 Y24* probably null Het
Masp2 A T 4: 148,613,778 T439S probably benign Het
Meioc G A 11: 102,668,400 W49* probably null Het
Mrvi1 T C 7: 110,899,735 E363G probably damaging Het
Mtor T G 4: 148,468,287 I749S probably benign Het
Myo16 T A 8: 10,562,078 V1241D unknown Het
Ncam2 G T 16: 81,443,248 R199L possibly damaging Het
Nyap2 A G 1: 81,241,057 S265G possibly damaging Het
Olfr1309 T A 2: 111,983,270 D268V probably damaging Het
Parp8 A T 13: 116,924,983 F175I probably damaging Het
Pcnx A G 12: 81,975,280 T823A Het
Phc2 T A 4: 128,711,062 I197N probably damaging Het
Pla2g16 C T 19: 7,579,161 T109I probably benign Het
Pot1a T C 6: 25,750,108 I518M probably benign Het
Prg2 T A 2: 84,982,260 C105S probably benign Het
Rab39 A G 9: 53,705,955 L54P possibly damaging Het
Rell1 T A 5: 63,939,721 probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc4a4 T C 5: 89,179,707 Y668H probably benign Het
Sncg C A 14: 34,374,770 probably benign Het
Spata31d1b A G 13: 59,715,449 D137G probably damaging Het
Tas1r1 C T 4: 152,028,346 G750D probably damaging Het
Tcea3 A T 4: 136,254,514 D61V probably damaging Het
Tfap2c T A 2: 172,551,472 H102Q probably damaging Het
Tmem150a T A 6: 72,358,323 L95H probably damaging Het
Tnfrsf11a A T 1: 105,817,684 D149V probably damaging Het
Tsc22d2 C A 3: 58,416,032 A115E probably benign Het
Vmn2r101 T A 17: 19,590,245 F431Y probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r85 C A 10: 130,429,495 E40* probably null Het
Zfp606 G A 7: 12,481,015 A57T possibly damaging Het
Zfp760 T C 17: 21,723,455 V537A probably benign Het
Other mutations in Cadm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Cadm3 APN 1 173341108 missense possibly damaging 0.66
IGL01989:Cadm3 APN 1 173338011 unclassified probably benign
IGL02224:Cadm3 APN 1 173338061 missense possibly damaging 0.51
IGL03105:Cadm3 APN 1 173345016 missense probably damaging 0.96
R0243:Cadm3 UTSW 1 173346573 unclassified probably benign
R0583:Cadm3 UTSW 1 173341171 missense probably benign 0.00
R0689:Cadm3 UTSW 1 173344452 missense possibly damaging 0.95
R2060:Cadm3 UTSW 1 173344402 missense probably damaging 1.00
R2859:Cadm3 UTSW 1 173346545 missense possibly damaging 0.90
R3764:Cadm3 UTSW 1 173346497 missense probably damaging 1.00
R4077:Cadm3 UTSW 1 173341669 missense probably benign 0.01
R4079:Cadm3 UTSW 1 173341669 missense probably benign 0.01
R4521:Cadm3 UTSW 1 173345063 splice site probably null
R4670:Cadm3 UTSW 1 173346446 missense probably damaging 1.00
R4965:Cadm3 UTSW 1 173337097 missense probably damaging 1.00
R5267:Cadm3 UTSW 1 173337102 missense probably damaging 1.00
R6273:Cadm3 UTSW 1 173349124 unclassified probably benign
R6315:Cadm3 UTSW 1 173344352 missense probably benign 0.16
R6342:Cadm3 UTSW 1 173341108 missense possibly damaging 0.66
R6544:Cadm3 UTSW 1 173367411 critical splice donor site probably null
R6565:Cadm3 UTSW 1 173341709 missense possibly damaging 0.81
R7813:Cadm3 UTSW 1 173344389 missense probably benign 0.00
R8024:Cadm3 UTSW 1 173338055 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGAGTGGGAGCTCATCTTTC -3'
(R):5'- CAAGGCCATGCTGACCATATC -3'

Sequencing Primer
(F):5'- CTATTGATTGAGCATTGCTACACAC -3'
(R):5'- AGGCCATGCTGACCATATCTCATC -3'
Posted On2020-06-30