Incidental Mutation 'R8078:Tsc22d2'
ID629125
Institutional Source Beutler Lab
Gene Symbol Tsc22d2
Ensembl Gene ENSMUSG00000027806
Gene NameTSC22 domain family, member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R8078 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location58414715-58466783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58416032 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 115 (A115E)
Ref Sequence ENSEMBL: ENSMUSP00000143364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099090] [ENSMUST00000199164]
Predicted Effect probably benign
Transcript: ENSMUST00000099090
AA Change: A115E

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096688
Gene: ENSMUSG00000027806
AA Change: A115E

DomainStartEndE-ValueType
low complexity region 95 145 N/A INTRINSIC
low complexity region 204 223 N/A INTRINSIC
low complexity region 253 286 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 426 439 N/A INTRINSIC
low complexity region 441 457 N/A INTRINSIC
low complexity region 459 521 N/A INTRINSIC
low complexity region 531 541 N/A INTRINSIC
Pfam:TSC22 683 739 4.1e-29 PFAM
low complexity region 746 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196049
Predicted Effect probably benign
Transcript: ENSMUST00000199164
AA Change: A115E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143364
Gene: ENSMUSG00000027806
AA Change: A115E

DomainStartEndE-ValueType
low complexity region 95 145 N/A INTRINSIC
low complexity region 204 223 N/A INTRINSIC
low complexity region 253 286 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 426 439 N/A INTRINSIC
low complexity region 441 457 N/A INTRINSIC
low complexity region 459 521 N/A INTRINSIC
low complexity region 531 541 N/A INTRINSIC
Pfam:TSC22 659 718 1.2e-28 PFAM
low complexity region 722 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.9%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,301,279 V2884I probably benign Het
Actl10 T A 2: 154,552,570 N147K probably benign Het
Agpat2 C A 2: 26,604,101 C37F possibly damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd26 T A 6: 118,517,893 probably null Het
Bcas1 T C 2: 170,418,612 E49G possibly damaging Het
Birc3 A G 9: 7,858,741 V331A probably damaging Het
Cadm3 A G 1: 173,341,059 V314A probably damaging Het
Cep290 T C 10: 100,572,887 V2407A probably benign Het
Chd5 C A 4: 152,360,991 N446K possibly damaging Het
Clec9a A G 6: 129,409,033 S27G probably benign Het
Coro1c G T 5: 113,882,103 A17E probably damaging Het
Cspg4 T C 9: 56,890,259 S1336P possibly damaging Het
Ddx55 G A 5: 124,566,388 V353M probably damaging Het
Farp1 T A 14: 121,276,300 S836T probably benign Het
Fbll1 G T 11: 35,797,901 D178E probably benign Het
Flg2 T G 3: 93,200,275 D22E probably damaging Het
Glis1 T A 4: 107,567,902 C237S probably damaging Het
Gm5519 T C 19: 33,822,957 V17A possibly damaging Het
Gucy2c C A 6: 136,697,921 G1055C probably damaging Het
Hspg2 T C 4: 137,508,022 Y123H probably damaging Het
Idh1 T A 1: 65,161,066 I380F probably damaging Het
Il23r A T 6: 67,423,593 N584K probably damaging Het
Lama1 A T 17: 67,791,294 T1829S Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Luzp2 T A 7: 55,052,762 Y24* probably null Het
Masp2 A T 4: 148,613,778 T439S probably benign Het
Meioc G A 11: 102,668,400 W49* probably null Het
Mrvi1 T C 7: 110,899,735 E363G probably damaging Het
Mtor T G 4: 148,468,287 I749S probably benign Het
Myo16 T A 8: 10,562,078 V1241D unknown Het
Ncam2 G T 16: 81,443,248 R199L possibly damaging Het
Nyap2 A G 1: 81,241,057 S265G possibly damaging Het
Olfr1309 T A 2: 111,983,270 D268V probably damaging Het
Parp8 A T 13: 116,924,983 F175I probably damaging Het
Pcnx A G 12: 81,975,280 T823A Het
Phc2 T A 4: 128,711,062 I197N probably damaging Het
Pla2g16 C T 19: 7,579,161 T109I probably benign Het
Pot1a T C 6: 25,750,108 I518M probably benign Het
Prg2 T A 2: 84,982,260 C105S probably benign Het
Rab39 A G 9: 53,705,955 L54P possibly damaging Het
Rell1 T A 5: 63,939,721 probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc4a4 T C 5: 89,179,707 Y668H probably benign Het
Sncg C A 14: 34,374,770 probably benign Het
Spata31d1b A G 13: 59,715,449 D137G probably damaging Het
Tas1r1 C T 4: 152,028,346 G750D probably damaging Het
Tcea3 A T 4: 136,254,514 D61V probably damaging Het
Tfap2c T A 2: 172,551,472 H102Q probably damaging Het
Tmem150a T A 6: 72,358,323 L95H probably damaging Het
Tnfrsf11a A T 1: 105,817,684 D149V probably damaging Het
Vmn2r101 T A 17: 19,590,245 F431Y probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r85 C A 10: 130,429,495 E40* probably null Het
Zfp606 G A 7: 12,481,015 A57T possibly damaging Het
Zfp760 T C 17: 21,723,455 V537A probably benign Het
Other mutations in Tsc22d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tsc22d2 APN 3 58417415 unclassified probably benign
IGL01389:Tsc22d2 APN 3 58416238 missense probably damaging 0.98
IGL01407:Tsc22d2 APN 3 58416503 missense probably damaging 0.99
IGL02193:Tsc22d2 APN 3 58460207 utr 3 prime probably benign
IGL02641:Tsc22d2 APN 3 58416155 missense probably damaging 1.00
IGL02956:Tsc22d2 APN 3 58417546 missense unknown
R0141:Tsc22d2 UTSW 3 58417156 unclassified probably benign
R0421:Tsc22d2 UTSW 3 58417328 unclassified probably benign
R1743:Tsc22d2 UTSW 3 58417539 frame shift probably null
R2214:Tsc22d2 UTSW 3 58416206 missense probably damaging 1.00
R5155:Tsc22d2 UTSW 3 58417316 unclassified probably benign
R5242:Tsc22d2 UTSW 3 58415939 missense possibly damaging 0.86
R5616:Tsc22d2 UTSW 3 58417162 unclassified probably benign
R6119:Tsc22d2 UTSW 3 58460253 utr 3 prime probably benign
R6454:Tsc22d2 UTSW 3 58415840 missense possibly damaging 0.92
R6855:Tsc22d2 UTSW 3 58416814 missense probably damaging 0.99
R6885:Tsc22d2 UTSW 3 58416208 missense probably damaging 1.00
R7148:Tsc22d2 UTSW 3 58417008 nonsense probably null
R7243:Tsc22d2 UTSW 3 58416463 missense unknown
R8309:Tsc22d2 UTSW 3 58417123 missense unknown
R8789:Tsc22d2 UTSW 3 58460017 nonsense probably null
Z1176:Tsc22d2 UTSW 3 58417024 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGTGTCCTCCGAGATCTTC -3'
(R):5'- GAATCCCGCTCGTAGTATTCCATAC -3'

Sequencing Primer
(F):5'- GAGATCTTCGACGTTTCCCGG -3'
(R):5'- GTAGTATTCCATACACGTCCATCGG -3'
Posted On2020-06-30