Incidental Mutation 'R8078:Flg2'
ID629126
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8078 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 93200275 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 22 (D22E)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
Predicted Effect probably damaging
Transcript: ENSMUST00000098884
AA Change: D22E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: D22E

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.9%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,301,279 V2884I probably benign Het
Actl10 T A 2: 154,552,570 N147K probably benign Het
Agpat2 C A 2: 26,604,101 C37F possibly damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd26 T A 6: 118,517,893 probably null Het
Bcas1 T C 2: 170,418,612 E49G possibly damaging Het
Birc3 A G 9: 7,858,741 V331A probably damaging Het
Cadm3 A G 1: 173,341,059 V314A probably damaging Het
Cep290 T C 10: 100,572,887 V2407A probably benign Het
Chd5 C A 4: 152,360,991 N446K possibly damaging Het
Clec9a A G 6: 129,409,033 S27G probably benign Het
Coro1c G T 5: 113,882,103 A17E probably damaging Het
Cspg4 T C 9: 56,890,259 S1336P possibly damaging Het
Ddx55 G A 5: 124,566,388 V353M probably damaging Het
Farp1 T A 14: 121,276,300 S836T probably benign Het
Fbll1 G T 11: 35,797,901 D178E probably benign Het
Glis1 T A 4: 107,567,902 C237S probably damaging Het
Gm5519 T C 19: 33,822,957 V17A possibly damaging Het
Gucy2c C A 6: 136,697,921 G1055C probably damaging Het
Hspg2 T C 4: 137,508,022 Y123H probably damaging Het
Idh1 T A 1: 65,161,066 I380F probably damaging Het
Il23r A T 6: 67,423,593 N584K probably damaging Het
Lama1 A T 17: 67,791,294 T1829S Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Luzp2 T A 7: 55,052,762 Y24* probably null Het
Masp2 A T 4: 148,613,778 T439S probably benign Het
Meioc G A 11: 102,668,400 W49* probably null Het
Mrvi1 T C 7: 110,899,735 E363G probably damaging Het
Mtor T G 4: 148,468,287 I749S probably benign Het
Myo16 T A 8: 10,562,078 V1241D unknown Het
Ncam2 G T 16: 81,443,248 R199L possibly damaging Het
Nyap2 A G 1: 81,241,057 S265G possibly damaging Het
Olfr1309 T A 2: 111,983,270 D268V probably damaging Het
Parp8 A T 13: 116,924,983 F175I probably damaging Het
Pcnx A G 12: 81,975,280 T823A Het
Phc2 T A 4: 128,711,062 I197N probably damaging Het
Pla2g16 C T 19: 7,579,161 T109I probably benign Het
Pot1a T C 6: 25,750,108 I518M probably benign Het
Prg2 T A 2: 84,982,260 C105S probably benign Het
Rab39 A G 9: 53,705,955 L54P possibly damaging Het
Rell1 T A 5: 63,939,721 probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc4a4 T C 5: 89,179,707 Y668H probably benign Het
Sncg C A 14: 34,374,770 probably benign Het
Spata31d1b A G 13: 59,715,449 D137G probably damaging Het
Tas1r1 C T 4: 152,028,346 G750D probably damaging Het
Tcea3 A T 4: 136,254,514 D61V probably damaging Het
Tfap2c T A 2: 172,551,472 H102Q probably damaging Het
Tmem150a T A 6: 72,358,323 L95H probably damaging Het
Tnfrsf11a A T 1: 105,817,684 D149V probably damaging Het
Tsc22d2 C A 3: 58,416,032 A115E probably benign Het
Vmn2r101 T A 17: 19,590,245 F431Y probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r85 C A 10: 130,429,495 E40* probably null Het
Zfp606 G A 7: 12,481,015 A57T possibly damaging Het
Zfp760 T C 17: 21,723,455 V537A probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- TGACCCATACTTGTATGTTGAGGTAG -3'
(R):5'- ACTGGGGTTTTCTCAGAGTCAG -3'

Sequencing Primer
(F):5'- CTGTATTAAAGGGTCACAGCATTAGG -3'
(R):5'- TCTCAGAGTCAGGTGGGGC -3'
Posted On2020-06-30