Incidental Mutation 'R8078:Pot1a'
ID 629140
Institutional Source Beutler Lab
Gene Symbol Pot1a
Ensembl Gene ENSMUSG00000029676
Gene Name protection of telomeres 1A
Synonyms 1500031H18Rik, Pot1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8078 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 25743737-25809246 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25750108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 518 (I518M)
Ref Sequence ENSEMBL: ENSMUSP00000110986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115330] [ENSMUST00000166445]
AlphaFold Q91WC1
Predicted Effect probably benign
Transcript: ENSMUST00000115330
AA Change: I518M

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676
AA Change: I518M

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
Pfam:POT1PC 152 299 6.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166445
AA Change: I518M

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676
AA Change: I518M

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,301,279 V2884I probably benign Het
Actl10 T A 2: 154,552,570 N147K probably benign Het
Agpat2 C A 2: 26,604,101 C37F possibly damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd26 T A 6: 118,517,893 probably null Het
Bcas1 T C 2: 170,418,612 E49G possibly damaging Het
Birc3 A G 9: 7,858,741 V331A probably damaging Het
Cadm3 A G 1: 173,341,059 V314A probably damaging Het
Cep290 T C 10: 100,572,887 V2407A probably benign Het
Chd5 C A 4: 152,360,991 N446K possibly damaging Het
Clec9a A G 6: 129,409,033 S27G probably benign Het
Coro1c G T 5: 113,882,103 A17E probably damaging Het
Cspg4 T C 9: 56,890,259 S1336P possibly damaging Het
Ddx55 G A 5: 124,566,388 V353M probably damaging Het
Farp1 T A 14: 121,276,300 S836T probably benign Het
Fbll1 G T 11: 35,797,901 D178E probably benign Het
Flg2 T G 3: 93,200,275 D22E probably damaging Het
Glis1 T A 4: 107,567,902 C237S probably damaging Het
Gm5519 T C 19: 33,822,957 V17A possibly damaging Het
Gucy2c C A 6: 136,697,921 G1055C probably damaging Het
Hspg2 T C 4: 137,508,022 Y123H probably damaging Het
Idh1 T A 1: 65,161,066 I380F probably damaging Het
Il23r A T 6: 67,423,593 N584K probably damaging Het
Lama1 A T 17: 67,791,294 T1829S Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Luzp2 T A 7: 55,052,762 Y24* probably null Het
Masp2 A T 4: 148,613,778 T439S probably benign Het
Meioc G A 11: 102,668,400 W49* probably null Het
Mrvi1 T C 7: 110,899,735 E363G probably damaging Het
Mtor T G 4: 148,468,287 I749S probably benign Het
Myo16 T A 8: 10,562,078 V1241D unknown Het
Ncam2 G T 16: 81,443,248 R199L possibly damaging Het
Nyap2 A G 1: 81,241,057 S265G possibly damaging Het
Olfr1309 T A 2: 111,983,270 D268V probably damaging Het
Parp8 A T 13: 116,924,983 F175I probably damaging Het
Pcnx A G 12: 81,975,280 T823A Het
Phc2 T A 4: 128,711,062 I197N probably damaging Het
Pla2g16 C T 19: 7,579,161 T109I probably benign Het
Prg2 T A 2: 84,982,260 C105S probably benign Het
Rab39 A G 9: 53,705,955 L54P possibly damaging Het
Rell1 T A 5: 63,939,721 probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc4a4 T C 5: 89,179,707 Y668H probably benign Het
Sncg C A 14: 34,374,770 probably benign Het
Spata31d1b A G 13: 59,715,449 D137G probably damaging Het
Tas1r1 C T 4: 152,028,346 G750D probably damaging Het
Tcea3 A T 4: 136,254,514 D61V probably damaging Het
Tfap2c T A 2: 172,551,472 H102Q probably damaging Het
Tmem150a T A 6: 72,358,323 L95H probably damaging Het
Tnfrsf11a A T 1: 105,817,684 D149V probably damaging Het
Tsc22d2 C A 3: 58,416,032 A115E probably benign Het
Vmn2r101 T A 17: 19,590,245 F431Y probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r85 C A 10: 130,429,495 E40* probably null Het
Zfp606 G A 7: 12,481,015 A57T possibly damaging Het
Zfp760 T C 17: 21,723,455 V537A probably benign Het
Other mutations in Pot1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Pot1a APN 6 25744628 missense probably benign 0.01
IGL01393:Pot1a APN 6 25744631 nonsense probably null
IGL01411:Pot1a APN 6 25750144 splice site probably benign
IGL01774:Pot1a APN 6 25753277 missense probably benign 0.00
IGL01981:Pot1a APN 6 25750100 missense probably damaging 1.00
IGL02404:Pot1a APN 6 25764432 splice site probably benign
IGL02530:Pot1a APN 6 25794593 missense probably damaging 1.00
IGL02755:Pot1a APN 6 25771613 missense possibly damaging 0.81
IGL03127:Pot1a APN 6 25794616 missense probably benign 0.00
IGL03396:Pot1a APN 6 25745914 missense possibly damaging 0.93
BB001:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
BB011:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R0329:Pot1a UTSW 6 25778831 splice site probably benign
R0359:Pot1a UTSW 6 25771680 splice site probably benign
R0530:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R0840:Pot1a UTSW 6 25748284 splice site probably benign
R0918:Pot1a UTSW 6 25756268 missense possibly damaging 0.92
R1650:Pot1a UTSW 6 25745965 missense probably damaging 1.00
R1937:Pot1a UTSW 6 25753324 missense probably benign 0.15
R2142:Pot1a UTSW 6 25750044 splice site probably null
R4072:Pot1a UTSW 6 25752357 splice site probably null
R4074:Pot1a UTSW 6 25752357 splice site probably null
R4322:Pot1a UTSW 6 25745930 missense probably benign 0.02
R4895:Pot1a UTSW 6 25753206 missense probably damaging 1.00
R4910:Pot1a UTSW 6 25746021 intron probably benign
R4933:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R5530:Pot1a UTSW 6 25778894 missense probably damaging 1.00
R5748:Pot1a UTSW 6 25758856 missense possibly damaging 0.77
R5775:Pot1a UTSW 6 25757298 splice site probably null
R5870:Pot1a UTSW 6 25778951 missense possibly damaging 0.90
R6180:Pot1a UTSW 6 25771621 missense probably benign 0.00
R6377:Pot1a UTSW 6 25778870 missense probably benign 0.06
R7251:Pot1a UTSW 6 25752498 splice site probably null
R7457:Pot1a UTSW 6 25771622 missense probably benign 0.26
R7679:Pot1a UTSW 6 25771634 missense probably benign 0.16
R7717:Pot1a UTSW 6 25758823 missense probably benign 0.45
R7924:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R8084:Pot1a UTSW 6 25771536 missense possibly damaging 0.81
R8170:Pot1a UTSW 6 25758803 makesense probably null
R9070:Pot1a UTSW 6 25744630 missense
Predicted Primers PCR Primer
(F):5'- TCGCAAGTAATTTAAACATTCAGTCC -3'
(R):5'- TTCTCTTGAAACAAGCATATTACAGT -3'

Sequencing Primer
(F):5'- GTCCTCATCCTCAAAACAATTACTG -3'
(R):5'- GTCCATTCTTGAATAGGATGTG -3'
Posted On 2020-06-30