Incidental Mutation 'R8078:Meioc'
ID 629157
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms Gm1564, LOC380729, LOC268491
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock # R8078 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102663716-102682237 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 102668400 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 49 (W49*)
Ref Sequence ENSEMBL: ENSMUSP00000116246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably null
Transcript: ENSMUST00000100378
AA Change: W105*
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: W105*

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156590
AA Change: W49*
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455
AA Change: W49*

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.9%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,301,279 V2884I probably benign Het
Actl10 T A 2: 154,552,570 N147K probably benign Het
Agpat2 C A 2: 26,604,101 C37F possibly damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd26 T A 6: 118,517,893 probably null Het
Bcas1 T C 2: 170,418,612 E49G possibly damaging Het
Birc3 A G 9: 7,858,741 V331A probably damaging Het
Cadm3 A G 1: 173,341,059 V314A probably damaging Het
Cep290 T C 10: 100,572,887 V2407A probably benign Het
Chd5 C A 4: 152,360,991 N446K possibly damaging Het
Clec9a A G 6: 129,409,033 S27G probably benign Het
Coro1c G T 5: 113,882,103 A17E probably damaging Het
Cspg4 T C 9: 56,890,259 S1336P possibly damaging Het
Ddx55 G A 5: 124,566,388 V353M probably damaging Het
Farp1 T A 14: 121,276,300 S836T probably benign Het
Fbll1 G T 11: 35,797,901 D178E probably benign Het
Flg2 T G 3: 93,200,275 D22E probably damaging Het
Glis1 T A 4: 107,567,902 C237S probably damaging Het
Gm5519 T C 19: 33,822,957 V17A possibly damaging Het
Gucy2c C A 6: 136,697,921 G1055C probably damaging Het
Hspg2 T C 4: 137,508,022 Y123H probably damaging Het
Idh1 T A 1: 65,161,066 I380F probably damaging Het
Il23r A T 6: 67,423,593 N584K probably damaging Het
Lama1 A T 17: 67,791,294 T1829S Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Luzp2 T A 7: 55,052,762 Y24* probably null Het
Masp2 A T 4: 148,613,778 T439S probably benign Het
Mrvi1 T C 7: 110,899,735 E363G probably damaging Het
Mtor T G 4: 148,468,287 I749S probably benign Het
Myo16 T A 8: 10,562,078 V1241D unknown Het
Ncam2 G T 16: 81,443,248 R199L possibly damaging Het
Nyap2 A G 1: 81,241,057 S265G possibly damaging Het
Olfr1309 T A 2: 111,983,270 D268V probably damaging Het
Parp8 A T 13: 116,924,983 F175I probably damaging Het
Pcnx A G 12: 81,975,280 T823A Het
Phc2 T A 4: 128,711,062 I197N probably damaging Het
Pla2g16 C T 19: 7,579,161 T109I probably benign Het
Pot1a T C 6: 25,750,108 I518M probably benign Het
Prg2 T A 2: 84,982,260 C105S probably benign Het
Rab39 A G 9: 53,705,955 L54P possibly damaging Het
Rell1 T A 5: 63,939,721 probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc4a4 T C 5: 89,179,707 Y668H probably benign Het
Sncg C A 14: 34,374,770 probably benign Het
Spata31d1b A G 13: 59,715,449 D137G probably damaging Het
Tas1r1 C T 4: 152,028,346 G750D probably damaging Het
Tcea3 A T 4: 136,254,514 D61V probably damaging Het
Tfap2c T A 2: 172,551,472 H102Q probably damaging Het
Tmem150a T A 6: 72,358,323 L95H probably damaging Het
Tnfrsf11a A T 1: 105,817,684 D149V probably damaging Het
Tsc22d2 C A 3: 58,416,032 A115E probably benign Het
Vmn2r101 T A 17: 19,590,245 F431Y probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r85 C A 10: 130,429,495 E40* probably null Het
Zfp606 G A 7: 12,481,015 A57T possibly damaging Het
Zfp760 T C 17: 21,723,455 V537A probably benign Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102674287 missense probably benign 0.33
IGL01952:Meioc APN 11 102672185 missense possibly damaging 0.79
IGL02006:Meioc APN 11 102674266 missense probably damaging 1.00
IGL02195:Meioc APN 11 102674857 missense possibly damaging 0.91
IGL02339:Meioc APN 11 102668448 missense probably benign 0.18
IGL02935:Meioc APN 11 102672191 missense probably benign 0.06
IGL03294:Meioc APN 11 102680669 missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102679957 missense probably damaging 1.00
R0285:Meioc UTSW 11 102672191 missense probably benign 0.06
R0964:Meioc UTSW 11 102680031 missense probably damaging 1.00
R1074:Meioc UTSW 11 102675393 missense probably damaging 1.00
R2024:Meioc UTSW 11 102675358 missense probably benign 0.00
R4012:Meioc UTSW 11 102675828 missense probably damaging 0.99
R4429:Meioc UTSW 11 102675720 missense probably damaging 1.00
R4491:Meioc UTSW 11 102674920 missense possibly damaging 0.84
R4594:Meioc UTSW 11 102674166 missense probably damaging 1.00
R4752:Meioc UTSW 11 102674433 missense probably benign 0.00
R5301:Meioc UTSW 11 102680045 missense probably damaging 1.00
R5352:Meioc UTSW 11 102675313 missense probably benign 0.03
R5646:Meioc UTSW 11 102675257 missense possibly damaging 0.94
R5958:Meioc UTSW 11 102675153 missense probably benign 0.41
R5968:Meioc UTSW 11 102675831 missense probably damaging 0.99
R6157:Meioc UTSW 11 102668401 missense probably damaging 1.00
R6410:Meioc UTSW 11 102675034 missense probably benign 0.00
R6644:Meioc UTSW 11 102668460 critical splice donor site probably null
R7285:Meioc UTSW 11 102666342 missense probably benign 0.00
R7440:Meioc UTSW 11 102674237 missense possibly damaging 0.67
R7815:Meioc UTSW 11 102675588 missense probably damaging 1.00
R7984:Meioc UTSW 11 102674606 missense possibly damaging 0.94
R8009:Meioc UTSW 11 102676743 missense probably damaging 1.00
R8195:Meioc UTSW 11 102675067 nonsense probably null
R8429:Meioc UTSW 11 102674206 missense probably benign 0.06
R8797:Meioc UTSW 11 102676860 nonsense probably null
R8854:Meioc UTSW 11 102675763 missense probably damaging 0.98
R8891:Meioc UTSW 11 102668420 missense probably benign 0.43
R9081:Meioc UTSW 11 102674175 missense probably benign 0.00
R9360:Meioc UTSW 11 102674953 missense probably benign 0.13
Z1177:Meioc UTSW 11 102666364 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGCTATCCCAACTTCTAACACCTG -3'
(R):5'- CTGCAGATCCAGCACTCAAG -3'

Sequencing Primer
(F):5'- CTTCTAACACCTGCATTATTATGT -3'
(R):5'- TGCAGATCCAGCACTCAAGAGATAAG -3'
Posted On 2020-06-30