Incidental Mutation 'R0698:Map4'
ID62916
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Namemicrotubule-associated protein 4
SynonymsMtap4, MAP 4
MMRRC Submission 038882-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0698 (G1)
Quality Score198
Status Not validated
Chromosome9
Chromosomal Location109931460-110083955 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 110068788 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 81 (R81*)
Ref Sequence ENSEMBL: ENSMUSP00000143408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000163979] [ENSMUST00000164930] [ENSMUST00000165876] [ENSMUST00000198511] [ENSMUST00000199161] [ENSMUST00000199461] [ENSMUST00000199498] [ENSMUST00000199548]
Predicted Effect probably null
Transcript: ENSMUST00000035055
AA Change: R861*
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479
AA Change: R861*

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163190
AA Change: R1321*
Predicted Effect probably null
Transcript: ENSMUST00000163979
AA Change: R150*
SMART Domains Protein: ENSMUSP00000129362
Gene: ENSMUSG00000032479
AA Change: R150*

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164930
AA Change: R708*
SMART Domains Protein: ENSMUSP00000131285
Gene: ENSMUSG00000032479
AA Change: R708*

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 6e-16 PFAM
Pfam:Tubulin-binding 774 804 4.5e-19 PFAM
Pfam:Tubulin-binding 805 835 2.3e-18 PFAM
Pfam:Tubulin-binding 836 867 1.6e-11 PFAM
low complexity region 902 917 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165876
AA Change: R861*
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479
AA Change: R861*

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198185
Predicted Effect probably benign
Transcript: ENSMUST00000198511
SMART Domains Protein: ENSMUSP00000142558
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Tubulin-binding 24 54 7.3e-14 PFAM
Pfam:Tubulin-binding 55 85 5.3e-17 PFAM
Pfam:Tubulin-binding 86 116 2.8e-16 PFAM
Pfam:Tubulin-binding 117 148 1.9e-9 PFAM
low complexity region 183 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199161
SMART Domains Protein: ENSMUSP00000143205
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
Pfam:Tubulin-binding 16 46 6.7e-14 PFAM
Pfam:Tubulin-binding 47 77 4.9e-17 PFAM
Pfam:Tubulin-binding 78 108 2.5e-16 PFAM
Pfam:Tubulin-binding 109 140 1.7e-9 PFAM
low complexity region 176 191 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199461
AA Change: R81*
SMART Domains Protein: ENSMUSP00000143296
Gene: ENSMUSG00000032479
AA Change: R81*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1e-13 PFAM
Pfam:Tubulin-binding 147 177 3.8e-16 PFAM
Pfam:Tubulin-binding 178 209 2.6e-9 PFAM
low complexity region 244 259 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199498
AA Change: R708*
SMART Domains Protein: ENSMUSP00000142439
Gene: ENSMUSG00000032479
AA Change: R708*

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199548
AA Change: R81*
SMART Domains Protein: ENSMUSP00000143408
Gene: ENSMUSG00000032479
AA Change: R81*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1.1e-13 PFAM
Pfam:Tubulin-binding 147 177 7.9e-17 PFAM
Pfam:Tubulin-binding 178 208 4.1e-16 PFAM
Pfam:Tubulin-binding 209 240 2.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 C T 16: 35,290,082 T873M possibly damaging Het
Ap4e1 G A 2: 127,063,363 E985K probably benign Het
Arhgap18 T C 10: 26,912,629 I579T probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Atm T C 9: 53,515,239 E573G probably damaging Het
Baz1b T C 5: 135,198,221 V92A probably damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Cpne4 T C 9: 104,925,795 S213P probably damaging Het
Dock10 T A 1: 80,530,178 Q1672L probably damaging Het
Grm8 C T 6: 27,363,914 C534Y probably damaging Het
Ints7 A G 1: 191,594,464 M183V probably damaging Het
Invs T G 4: 48,396,364 S346A probably benign Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Lrrtm4 T C 6: 80,022,928 L441P probably damaging Het
Med1 A G 11: 98,155,689 probably benign Het
Necab1 T C 4: 15,005,041 N141S probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Pcdhb2 A T 18: 37,297,366 E797D probably benign Het
Pclo T C 5: 14,712,516 Y3668H unknown Het
Peg10 T A 6: 4,756,835 probably benign Het
Psd2 A G 18: 36,012,711 I723V probably benign Het
Ptprn2 C T 12: 116,722,130 R70* probably null Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab13 C T 3: 90,224,736 T69M probably damaging Het
Rpl32 T C 6: 115,805,590 N126S probably benign Het
Sis C A 3: 72,910,498 A1461S probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Spta1 T C 1: 174,181,104 L258P probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tet2 A T 3: 133,467,384 S1706T probably benign Het
Ttc6 G A 12: 57,673,216 V858I probably benign Het
Vps13c C A 9: 67,889,723 A464E probably benign Het
Zbtb17 T C 4: 141,466,096 probably null Het
Zcchc11 T A 4: 108,555,533 M1477K probably benign Het
Zcwpw1 G A 5: 137,817,521 E429K probably benign Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 110072604 splice site probably benign
IGL01331:Map4 APN 9 110034801 missense probably benign 0.04
IGL01599:Map4 APN 9 110034768 missense probably benign 0.26
IGL01631:Map4 APN 9 110063133 unclassified probably benign
IGL02208:Map4 APN 9 109978870 start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109999833 missense probably benign 0.15
IGL02625:Map4 APN 9 110064417 missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 110072614 missense probably damaging 1.00
R0149:Map4 UTSW 9 110067624 missense probably damaging 0.96
R0384:Map4 UTSW 9 110034628 missense probably damaging 0.99
R0392:Map4 UTSW 9 110078045 missense probably damaging 1.00
R0496:Map4 UTSW 9 110039850 intron probably benign
R0526:Map4 UTSW 9 110037278 splice site probably null
R0555:Map4 UTSW 9 109979103 splice site probably benign
R0571:Map4 UTSW 9 110036766 missense probably benign 0.00
R0762:Map4 UTSW 9 110038478 intron probably benign
R0862:Map4 UTSW 9 109978969 missense probably damaging 1.00
R0864:Map4 UTSW 9 109978969 missense probably damaging 1.00
R1168:Map4 UTSW 9 110034964 missense probably benign 0.00
R1238:Map4 UTSW 9 110068580 missense probably benign 0.00
R1735:Map4 UTSW 9 110034955 missense probably benign 0.00
R1869:Map4 UTSW 9 110034964 missense probably benign 0.00
R1869:Map4 UTSW 9 110068928 missense possibly damaging 0.95
R2196:Map4 UTSW 9 110071048 missense probably damaging 1.00
R2264:Map4 UTSW 9 110081457 missense probably damaging 1.00
R2507:Map4 UTSW 9 110037483 intron probably benign
R2512:Map4 UTSW 9 110034702 missense possibly damaging 0.48
R3087:Map4 UTSW 9 110053189 missense possibly damaging 0.84
R3154:Map4 UTSW 9 109999792 missense probably benign 0.19
R3498:Map4 UTSW 9 110035212 missense probably benign 0.03
R3547:Map4 UTSW 9 110052198 missense possibly damaging 0.61
R3751:Map4 UTSW 9 110038674 intron probably benign
R4036:Map4 UTSW 9 110032215 missense possibly damaging 0.47
R4423:Map4 UTSW 9 110067594 missense probably damaging 1.00
R4505:Map4 UTSW 9 110032185 missense probably benign 0.01
R4561:Map4 UTSW 9 110052371 missense possibly damaging 0.91
R4577:Map4 UTSW 9 110081421 missense possibly damaging 0.48
R4601:Map4 UTSW 9 110052819 missense possibly damaging 0.75
R4795:Map4 UTSW 9 110035263 missense probably benign 0.00
R4801:Map4 UTSW 9 110035257 missense probably benign 0.15
R4802:Map4 UTSW 9 110035257 missense probably benign 0.15
R4999:Map4 UTSW 9 110038377 intron probably benign
R5020:Map4 UTSW 9 110068800 missense probably benign 0.02
R5021:Map4 UTSW 9 110038089 nonsense probably null
R5049:Map4 UTSW 9 110079814 nonsense probably null
R5451:Map4 UTSW 9 110037783 intron probably benign
R5452:Map4 UTSW 9 110037783 intron probably benign
R5453:Map4 UTSW 9 110037783 intron probably benign
R5492:Map4 UTSW 9 110052382 missense possibly damaging 0.68
R5532:Map4 UTSW 9 110034678 missense probably benign 0.24
R5602:Map4 UTSW 9 110052700 missense possibly damaging 0.84
R5628:Map4 UTSW 9 110081847 missense probably benign 0.04
R5896:Map4 UTSW 9 110072634 missense possibly damaging 0.91
R6017:Map4 UTSW 9 110034619 missense probably benign 0.00
R6084:Map4 UTSW 9 110064292 missense probably damaging 1.00
R6294:Map4 UTSW 9 110002746 missense possibly damaging 0.82
R6397:Map4 UTSW 9 110027716 missense possibly damaging 0.78
R6773:Map4 UTSW 9 110034925 missense probably benign 0.00
R6997:Map4 UTSW 9 110052914 missense probably benign 0.35
R7141:Map4 UTSW 9 109978870 start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 110053133 missense probably benign 0.03
R7320:Map4 UTSW 9 110081517 missense probably benign 0.24
R7469:Map4 UTSW 9 110027797 splice site probably null
R7479:Map4 UTSW 9 110068824 missense possibly damaging 0.94
R7487:Map4 UTSW 9 110027715 missense probably damaging 1.00
R7690:Map4 UTSW 9 109999793 missense probably damaging 0.99
R7780:Map4 UTSW 9 110034652 missense probably benign 0.00
R7998:Map4 UTSW 9 110079861 missense probably damaging 1.00
R8028:Map4 UTSW 9 110068744 missense probably damaging 1.00
Z1177:Map4 UTSW 9 110068523 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCCATGTGTACTTGTGCAGCC -3'
(R):5'- TGGAGCGAACACTCTTCAGGTCAG -3'

Sequencing Primer
(F):5'- TGCCTCAGGTAATGCCTAAG -3'
(R):5'- TCTTCAGGTCAGGGGCAG -3'
Posted On2013-07-30