Mutagenetix > Incidental Mutation

Incidental Mutation 'R8078:Vmn2r111'

629165

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8078 (G1)

Quality Score

216.009

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22559051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 95.9%

Validation Efficiency

100% (63/63)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	A	11: 9,301,279	V2884I	probably benign	Het
Actl10	T	A	2: 154,552,570	N147K	probably benign	Het
Agpat2	C	A	2: 26,604,101	C37F	possibly damaging	Het
Alb	G	C	5: 90,467,355	R242P	probably damaging	Het
Ankrd26	T	A	6: 118,517,893		probably null	Het
Bcas1	T	C	2: 170,418,612	E49G	possibly damaging	Het
Birc3	A	G	9: 7,858,741	V331A	probably damaging	Het
Cadm3	A	G	1: 173,341,059	V314A	probably damaging	Het
Cep290	T	C	10: 100,572,887	V2407A	probably benign	Het
Chd5	C	A	4: 152,360,991	N446K	possibly damaging	Het
Clec9a	A	G	6: 129,409,033	S27G	probably benign	Het
Coro1c	G	T	5: 113,882,103	A17E	probably damaging	Het
Cspg4	T	C	9: 56,890,259	S1336P	possibly damaging	Het
Ddx55	G	A	5: 124,566,388	V353M	probably damaging	Het
Farp1	T	A	14: 121,276,300	S836T	probably benign	Het
Fbll1	G	T	11: 35,797,901	D178E	probably benign	Het
Flg2	T	G	3: 93,200,275	D22E	probably damaging	Het
Glis1	T	A	4: 107,567,902	C237S	probably damaging	Het
Gm5519	T	C	19: 33,822,957	V17A	possibly damaging	Het
Gucy2c	C	A	6: 136,697,921	G1055C	probably damaging	Het
Hspg2	T	C	4: 137,508,022	Y123H	probably damaging	Het
Idh1	T	A	1: 65,161,066	I380F	probably damaging	Het
Il23r	A	T	6: 67,423,593	N584K	probably damaging	Het
Lama1	A	T	17: 67,791,294	T1829S		Het
Ldlrad1	G	A	4: 107,209,491	A8T	probably benign	Het
Luzp2	T	A	7: 55,052,762	Y24*	probably null	Het
Masp2	A	T	4: 148,613,778	T439S	probably benign	Het
Meioc	G	A	11: 102,668,400	W49*	probably null	Het
Mrvi1	T	C	7: 110,899,735	E363G	probably damaging	Het
Mtor	T	G	4: 148,468,287	I749S	probably benign	Het
Myo16	T	A	8: 10,562,078	V1241D	unknown	Het
Ncam2	G	T	16: 81,443,248	R199L	possibly damaging	Het
Nyap2	A	G	1: 81,241,057	S265G	possibly damaging	Het
Olfr1309	T	A	2: 111,983,270	D268V	probably damaging	Het
Parp8	A	T	13: 116,924,983	F175I	probably damaging	Het
Pcnx	A	G	12: 81,975,280	T823A		Het
Phc2	T	A	4: 128,711,062	I197N	probably damaging	Het
Pla2g16	C	T	19: 7,579,161	T109I	probably benign	Het
Pot1a	T	C	6: 25,750,108	I518M	probably benign	Het
Prg2	T	A	2: 84,982,260	C105S	probably benign	Het
Rab39	A	G	9: 53,705,955	L54P	possibly damaging	Het
Rell1	T	A	5: 63,939,721		probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Slc4a4	T	C	5: 89,179,707	Y668H	probably benign	Het
Sncg	C	A	14: 34,374,770		probably benign	Het
Spata31d1b	A	G	13: 59,715,449	D137G	probably damaging	Het
Tas1r1	C	T	4: 152,028,346	G750D	probably damaging	Het
Tcea3	A	T	4: 136,254,514	D61V	probably damaging	Het
Tfap2c	T	A	2: 172,551,472	H102Q	probably damaging	Het
Tmem150a	T	A	6: 72,358,323	L95H	probably damaging	Het
Tnfrsf11a	A	T	1: 105,817,684	D149V	probably damaging	Het
Tsc22d2	C	A	3: 58,416,032	A115E	probably benign	Het
Vmn2r101	T	A	17: 19,590,245	F431Y	probably benign	Het
Vmn2r85	C	A	10: 130,429,495	E40*	probably null	Het
Zfp606	G	A	7: 12,481,015	A57T	possibly damaging	Het
Zfp760	T	C	17: 21,723,455	V537A	probably benign	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTGTAAAAGATGCAGCCC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2020-06-30