Incidental Mutation 'R0698:Taar2'
ID62917
Institutional Source Beutler Lab
Gene Symbol Taar2
Ensembl Gene ENSMUSG00000059763
Gene Nametrace amine-associated receptor 2
SynonymsGpr58
MMRRC Submission 038882-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0698 (G1)
Quality Score154
Status Not validated
Chromosome10
Chromosomal Location23938572-23941583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23941495 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 311 (R311H)
Ref Sequence ENSEMBL: ENSMUSP00000078137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079134]
Predicted Effect probably benign
Transcript: ENSMUST00000079134
AA Change: R311H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000078137
Gene: ENSMUSG00000059763
AA Change: R311H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 318 2.4e-10 PFAM
Pfam:7tm_1 48 303 2.9e-54 PFAM
Meta Mutation Damage Score 0.4819 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 C T 16: 35,290,082 T873M possibly damaging Het
Ap4e1 G A 2: 127,063,363 E985K probably benign Het
Arhgap18 T C 10: 26,912,629 I579T probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Atm T C 9: 53,515,239 E573G probably damaging Het
Baz1b T C 5: 135,198,221 V92A probably damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Cpne4 T C 9: 104,925,795 S213P probably damaging Het
Dock10 T A 1: 80,530,178 Q1672L probably damaging Het
Grm8 C T 6: 27,363,914 C534Y probably damaging Het
Ints7 A G 1: 191,594,464 M183V probably damaging Het
Invs T G 4: 48,396,364 S346A probably benign Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Lrrtm4 T C 6: 80,022,928 L441P probably damaging Het
Map4 C T 9: 110,068,788 R81* probably null Het
Med1 A G 11: 98,155,689 probably benign Het
Necab1 T C 4: 15,005,041 N141S probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Pcdhb2 A T 18: 37,297,366 E797D probably benign Het
Pclo T C 5: 14,712,516 Y3668H unknown Het
Peg10 T A 6: 4,756,835 probably benign Het
Psd2 A G 18: 36,012,711 I723V probably benign Het
Ptprn2 C T 12: 116,722,130 R70* probably null Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab13 C T 3: 90,224,736 T69M probably damaging Het
Rpl32 T C 6: 115,805,590 N126S probably benign Het
Sis C A 3: 72,910,498 A1461S probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Spta1 T C 1: 174,181,104 L258P probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tet2 A T 3: 133,467,384 S1706T probably benign Het
Ttc6 G A 12: 57,673,216 V858I probably benign Het
Vps13c C A 9: 67,889,723 A464E probably benign Het
Zbtb17 T C 4: 141,466,096 probably null Het
Zcchc11 T A 4: 108,555,533 M1477K probably benign Het
Zcwpw1 G A 5: 137,817,521 E429K probably benign Het
Other mutations in Taar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Taar2 APN 10 23941368 missense possibly damaging 0.50
IGL00807:Taar2 APN 10 23940675 missense probably benign 0.00
IGL01346:Taar2 APN 10 23941099 missense probably damaging 1.00
IGL01433:Taar2 APN 10 23940759 missense probably benign 0.02
IGL01782:Taar2 APN 10 23941144 missense probably damaging 1.00
IGL03106:Taar2 APN 10 23941297 missense probably damaging 0.99
IGL03372:Taar2 APN 10 23941171 missense probably benign 0.03
R0046:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0046:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0090:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0101:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0101:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0103:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0157:Taar2 UTSW 10 23941491 missense probably damaging 1.00
R0189:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0190:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0226:Taar2 UTSW 10 23941063 missense probably damaging 1.00
R0226:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0265:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0267:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0349:Taar2 UTSW 10 23941429 missense possibly damaging 0.79
R0349:Taar2 UTSW 10 23941509 missense probably benign 0.01
R0426:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0556:Taar2 UTSW 10 23940895 missense probably damaging 1.00
R1191:Taar2 UTSW 10 23941029 missense probably damaging 1.00
R2919:Taar2 UTSW 10 23941556 missense probably benign 0.00
R4615:Taar2 UTSW 10 23941365 missense probably benign 0.43
R4658:Taar2 UTSW 10 23941503 missense probably benign 0.04
R4766:Taar2 UTSW 10 23940771 missense probably damaging 0.98
R4872:Taar2 UTSW 10 23940693 missense probably benign 0.02
R5205:Taar2 UTSW 10 23940976 missense probably benign 0.42
R5271:Taar2 UTSW 10 23941032 missense probably damaging 0.97
R5517:Taar2 UTSW 10 23940729 missense possibly damaging 0.92
R6033:Taar2 UTSW 10 23940976 missense probably benign
R6033:Taar2 UTSW 10 23940976 missense probably benign
R6325:Taar2 UTSW 10 23940717 missense probably benign 0.05
R6398:Taar2 UTSW 10 23941279 missense probably benign 0.00
R6762:Taar2 UTSW 10 23941402 missense probably damaging 0.98
R7121:Taar2 UTSW 10 23940827 missense probably damaging 1.00
R7209:Taar2 UTSW 10 23940699 missense possibly damaging 0.57
R7709:Taar2 UTSW 10 23940723 missense probably benign 0.00
R8045:Taar2 UTSW 10 23941488 missense probably damaging 1.00
R8223:Taar2 UTSW 10 23941350 missense probably damaging 1.00
Z1176:Taar2 UTSW 10 23941186 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTCGCGTAATTGACAACTTGCC -3'
(R):5'- TCAGTCTCCTAAGCCCCTTGAAGC -3'

Sequencing Primer
(F):5'- CAGCCAAAACTTTAGGGATAGTG -3'
(R):5'- GCAAATTCATTCTTTGAGTGCCAG -3'
Posted On2013-07-30