Incidental Mutation 'R8079:Chit1'
ID629171
Institutional Source Beutler Lab
Gene Symbol Chit1
Ensembl Gene ENSMUSG00000026450
Gene Namechitinase 1 (chitotriosidase)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R8079 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location134111242-134151540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134144027 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 92 (T92A)
Ref Sequence ENSEMBL: ENSMUSP00000083666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086475] [ENSMUST00000159963] [ENSMUST00000160060]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086475
AA Change: T92A

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083666
Gene: ENSMUSG00000026450
AA Change: T92A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 361 6.69e-151 SMART
ChtBD2 416 464 5.56e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159963
AA Change: T92A

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123979
Gene: ENSMUSG00000026450
AA Change: T92A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 361 6.69e-151 SMART
ChtBD2 416 464 5.56e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160060
AA Change: T92A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124331
Gene: ENSMUSG00000026450
AA Change: T92A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 354 2.47e-131 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced pulmonary fibrosis induced by bleomycin or IL13 expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,083,123 I255T possibly damaging Het
Ablim1 A T 19: 57,182,224 probably null Het
Akap10 G A 11: 61,930,054 P8L possibly damaging Het
Ankle2 C T 5: 110,231,316 A27V probably damaging Het
Anxa8 A G 14: 34,094,812 T246A probably benign Het
Arhgap5 A G 12: 52,567,205 N1460S probably benign Het
Arid5b T G 10: 68,098,356 D572A possibly damaging Het
Atrn T A 2: 131,013,641 L1278Q probably null Het
AU040320 G T 4: 126,832,160 K454N possibly damaging Het
Baz2b T A 2: 59,900,768 R2085W probably damaging Het
Bbx A T 16: 50,210,458 N649K probably damaging Het
BC034090 G A 1: 155,225,286 P411S probably damaging Het
Calcoco2 A T 11: 96,107,537 F20Y probably damaging Het
Carmil2 A G 8: 105,686,761 R50G probably damaging Het
Catspere2 A G 1: 178,046,959 T131A probably benign Het
Cdcp1 C A 9: 123,173,790 V739L probably damaging Het
Clstn3 A G 6: 124,459,804 I185T probably damaging Het
Dctpp1 C A 7: 127,259,389 V61L probably damaging Het
Dip2a T C 10: 76,287,321 T760A probably benign Het
Dock10 C T 1: 80,578,704 V552I probably benign Het
Dpcr1 T C 17: 35,638,192 T172A unknown Het
Dpp8 A G 9: 65,043,735 E151G probably damaging Het
Dvl2 G C 11: 70,007,518 R367P possibly damaging Het
Fem1b A T 9: 62,796,361 I539N probably damaging Het
Frat2 A T 19: 41,847,838 L25H probably damaging Het
Garnl3 A T 2: 33,018,499 probably null Het
Gh T C 11: 106,301,427 H47R possibly damaging Het
Glmp T C 3: 88,325,738 V61A probably damaging Het
Gm6614 T G 6: 141,987,734 M462L probably benign Het
Gm9925 T C 18: 74,065,487 V129A unknown Het
H2-M9 T A 17: 36,642,133 E94V probably benign Het
Hira A T 16: 18,925,757 Q408L probably benign Het
Hook3 A G 8: 26,088,058 probably null Het
Ifi206 G A 1: 173,481,158 P424L Het
Impdh2 T C 9: 108,563,325 V270A probably benign Het
Klhl14 A G 18: 21,651,965 I135T probably benign Het
Klra10 C A 6: 130,275,775 V179L probably benign Het
Kmt2c T C 5: 25,302,732 S3236G probably damaging Het
Krt76 G T 15: 101,888,390 A358D possibly damaging Het
Lacc1 C A 14: 77,029,552 G424C probably damaging Het
Limch1 A G 5: 67,046,753 I878V possibly damaging Het
Lipi C T 16: 75,565,530 probably null Het
Lrrc17 C T 5: 21,561,071 R184W probably damaging Het
Mllt10 A G 2: 18,123,756 N183D probably damaging Het
Mterf2 C T 10: 85,120,163 G199D probably damaging Het
Nat8f4 A T 6: 85,900,994 S182R probably benign Het
Ndrg3 C A 2: 156,937,532 E238* probably null Het
Nop14 A T 5: 34,654,461 L194H probably damaging Het
Obscn T C 11: 59,081,905 E2105G possibly damaging Het
Olfr1009 A T 2: 85,722,043 T213S probably benign Het
Olfr1079 T A 2: 86,538,381 H176L possibly damaging Het
Olfr1457 A C 19: 13,095,284 Y121* probably null Het
Olfr829 A T 9: 18,857,429 Y259F possibly damaging Het
Pbx3 C T 2: 34,178,228 A320T probably benign Het
Pcdhac2 A T 18: 37,146,144 S726C probably damaging Het
Pcdhgb2 A G 18: 37,690,763 D269G probably damaging Het
Pcgf6 A T 19: 47,045,832 S257T probably damaging Het
Pclo A T 5: 14,540,458 H924L unknown Het
Per3 T A 4: 151,042,678 T129S possibly damaging Het
Pi4ka A T 16: 17,303,060 M1270K Het
Plec G A 15: 76,179,550 Q2277* probably null Het
Pnma1 T A 12: 84,147,335 K198M probably damaging Het
Prc1 T A 7: 80,304,767 F196L possibly damaging Het
Prkcz T C 4: 155,357,505 T57A probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Robo4 A G 9: 37,402,635 M61V possibly damaging Het
Rps12 C T 10: 23,785,677 V79I probably benign Het
Rsph3a A G 17: 7,979,188 K466E probably benign Het
Scly A T 1: 91,308,367 I168F probably damaging Het
Setd1a T A 7: 127,785,053 F359I unknown Het
Sh3tc1 A G 5: 35,706,857 L662P possibly damaging Het
Slc12a5 T C 2: 164,992,452 W798R probably damaging Het
Slc16a6 C T 11: 109,473,455 R13Q unknown Het
Smarcad1 A G 6: 65,052,782 D118G possibly damaging Het
Sos2 T C 12: 69,607,215 T788A probably damaging Het
Syvn1 A G 19: 6,048,366 E75G probably null Het
Thpo T C 16: 20,726,394 E103G probably benign Het
Trav7d-3 A T 14: 52,744,736 E78V possibly damaging Het
Uap1 A G 1: 170,158,763 S217P probably damaging Het
Unc45a T G 7: 80,331,562 R497S probably damaging Het
Upf1 A G 8: 70,338,884 probably null Het
Usp47 A T 7: 112,046,970 K28M probably damaging Het
Wdr72 A C 9: 74,218,772 T1062P probably damaging Het
Wnt7b A T 15: 85,537,445 C339S probably damaging Het
Zfp954 G T 7: 7,115,471 T358K probably benign Het
Zmynd15 G T 11: 70,459,452 probably benign Het
Other mutations in Chit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Chit1 APN 1 134145254 missense probably damaging 1.00
IGL01344:Chit1 APN 1 134151314 missense probably damaging 1.00
IGL01352:Chit1 APN 1 134148490 missense probably damaging 1.00
IGL01620:Chit1 APN 1 134150519 missense probably damaging 1.00
IGL01795:Chit1 APN 1 134148429 missense probably damaging 1.00
IGL01924:Chit1 APN 1 134149410 missense probably benign 0.05
IGL02000:Chit1 APN 1 134146675 missense probably benign 0.01
IGL02891:Chit1 APN 1 134145310 missense probably benign 0.38
Debt UTSW 1 134149425 missense probably null 1.00
R0790:Chit1 UTSW 1 134138752 missense probably benign 0.00
R0838:Chit1 UTSW 1 134143337 nonsense probably null
R1783:Chit1 UTSW 1 134149394 missense possibly damaging 0.67
R1783:Chit1 UTSW 1 134149395 missense probably benign 0.03
R1784:Chit1 UTSW 1 134149394 missense possibly damaging 0.67
R1863:Chit1 UTSW 1 134151250 missense probably damaging 0.96
R1940:Chit1 UTSW 1 134145418 critical splice donor site probably null
R1950:Chit1 UTSW 1 134151230 missense probably damaging 1.00
R2045:Chit1 UTSW 1 134151144 missense probably benign 0.05
R2260:Chit1 UTSW 1 134151127 missense probably benign
R4552:Chit1 UTSW 1 134144051 missense probably benign 0.17
R5386:Chit1 UTSW 1 134149454 missense probably damaging 1.00
R5975:Chit1 UTSW 1 134146626 missense probably damaging 1.00
R6134:Chit1 UTSW 1 134144060 missense possibly damaging 0.94
R6196:Chit1 UTSW 1 134146643 nonsense probably null
R6482:Chit1 UTSW 1 134143242 missense probably damaging 0.98
R6923:Chit1 UTSW 1 134149425 missense probably null 1.00
R6952:Chit1 UTSW 1 134143284 missense probably damaging 1.00
R7022:Chit1 UTSW 1 134151292 missense probably benign 0.44
R7198:Chit1 UTSW 1 134150491 missense possibly damaging 0.87
R8278:Chit1 UTSW 1 134150594 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTCACCCACAAAGTCTTTCC -3'
(R):5'- GCCATTGTACCCTGTTGAGG -3'

Sequencing Primer
(F):5'- AAAGTCTTTCCTCTCCAGATCTGCAG -3'
(R):5'- TCTAGAACCAGAGGGAAAAGCC -3'
Posted On2020-06-30