Incidental Mutation 'R0698:Arhgap18'
ID62918
Institutional Source Beutler Lab
Gene Symbol Arhgap18
Ensembl Gene ENSMUSG00000039031
Gene NameRho GTPase activating protein 18
Synonyms
MMRRC Submission 038882-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0698 (G1)
Quality Score130
Status Not validated
Chromosome10
Chromosomal Location26753421-26918648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26912629 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 579 (I579T)
Ref Sequence ENSEMBL: ENSMUSP00000044834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039557]
Predicted Effect probably damaging
Transcript: ENSMUST00000039557
AA Change: I579T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044834
Gene: ENSMUSG00000039031
AA Change: I579T

DomainStartEndE-ValueType
low complexity region 100 114 N/A INTRINSIC
RhoGAP 340 520 8.99e-42 SMART
coiled coil region 535 557 N/A INTRINSIC
Blast:RhoGAP 572 613 1e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142284
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP18 belongs to a family of Rho (see MIM 165390) GTPase-activating proteins that modulate cell signaling (Potkin et al., 2009 [PubMed 19065146]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 C T 16: 35,290,082 T873M possibly damaging Het
Ap4e1 G A 2: 127,063,363 E985K probably benign Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Atm T C 9: 53,515,239 E573G probably damaging Het
Baz1b T C 5: 135,198,221 V92A probably damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Cpne4 T C 9: 104,925,795 S213P probably damaging Het
Dock10 T A 1: 80,530,178 Q1672L probably damaging Het
Grm8 C T 6: 27,363,914 C534Y probably damaging Het
Ints7 A G 1: 191,594,464 M183V probably damaging Het
Invs T G 4: 48,396,364 S346A probably benign Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Lrrtm4 T C 6: 80,022,928 L441P probably damaging Het
Map4 C T 9: 110,068,788 R81* probably null Het
Med1 A G 11: 98,155,689 probably benign Het
Necab1 T C 4: 15,005,041 N141S probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Pcdhb2 A T 18: 37,297,366 E797D probably benign Het
Pclo T C 5: 14,712,516 Y3668H unknown Het
Peg10 T A 6: 4,756,835 probably benign Het
Psd2 A G 18: 36,012,711 I723V probably benign Het
Ptprn2 C T 12: 116,722,130 R70* probably null Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab13 C T 3: 90,224,736 T69M probably damaging Het
Rpl32 T C 6: 115,805,590 N126S probably benign Het
Sis C A 3: 72,910,498 A1461S probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Spta1 T C 1: 174,181,104 L258P probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tet2 A T 3: 133,467,384 S1706T probably benign Het
Ttc6 G A 12: 57,673,216 V858I probably benign Het
Vps13c C A 9: 67,889,723 A464E probably benign Het
Zbtb17 T C 4: 141,466,096 probably null Het
Zcchc11 T A 4: 108,555,533 M1477K probably benign Het
Zcwpw1 G A 5: 137,817,521 E429K probably benign Het
Other mutations in Arhgap18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Arhgap18 APN 10 26880748 missense possibly damaging 0.75
IGL02393:Arhgap18 APN 10 26877183 missense probably benign 0.07
IGL03368:Arhgap18 APN 10 26772693 missense possibly damaging 0.60
Half_pint UTSW 10 26772698 critical splice donor site probably null
R1456:Arhgap18 UTSW 10 26916440 missense probably benign 0.29
R1532:Arhgap18 UTSW 10 26860722 missense possibly damaging 0.69
R1768:Arhgap18 UTSW 10 26887861 missense probably damaging 1.00
R1768:Arhgap18 UTSW 10 26887862 missense probably damaging 1.00
R1793:Arhgap18 UTSW 10 26860736 unclassified probably benign
R1867:Arhgap18 UTSW 10 26846030 missense probably damaging 0.99
R2020:Arhgap18 UTSW 10 26854904 missense probably benign
R2049:Arhgap18 UTSW 10 26849942 missense probably benign 0.00
R2056:Arhgap18 UTSW 10 26854908 missense probably benign 0.03
R2058:Arhgap18 UTSW 10 26854908 missense probably benign 0.03
R2986:Arhgap18 UTSW 10 26854907 missense probably benign 0.00
R3027:Arhgap18 UTSW 10 26846096 missense probably benign
R5103:Arhgap18 UTSW 10 26869982 missense probably damaging 1.00
R5468:Arhgap18 UTSW 10 26912671 missense probably damaging 0.99
R5532:Arhgap18 UTSW 10 26846108 missense possibly damaging 0.56
R5710:Arhgap18 UTSW 10 26860733 splice site probably null
R6019:Arhgap18 UTSW 10 26860650 missense probably damaging 0.98
R6190:Arhgap18 UTSW 10 26846035 start codon destroyed probably null 0.22
R6346:Arhgap18 UTSW 10 26846065 missense probably damaging 1.00
R6438:Arhgap18 UTSW 10 26772698 critical splice donor site probably null
R6572:Arhgap18 UTSW 10 26846416 splice site probably null
R6799:Arhgap18 UTSW 10 26849921 missense possibly damaging 0.57
R6844:Arhgap18 UTSW 10 26772686 missense probably benign 0.04
R7051:Arhgap18 UTSW 10 26849921 missense possibly damaging 0.57
R7084:Arhgap18 UTSW 10 26872738 missense possibly damaging 0.77
R7727:Arhgap18 UTSW 10 26870011 missense possibly damaging 0.83
R8046:Arhgap18 UTSW 10 26887857 missense probably damaging 0.98
R8252:Arhgap18 UTSW 10 26854936 missense probably benign 0.00
R8392:Arhgap18 UTSW 10 26845940 missense probably benign 0.38
Z1088:Arhgap18 UTSW 10 26850004 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTGCACAGGCATTATAAAGTTCCCC -3'
(R):5'- GCTGCTCACATAGGCTGCATAAAAC -3'

Sequencing Primer
(F):5'- GTTCCCCTATCACCATTAAGAGG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-07-30