Incidental Mutation 'R8079:AU040320'
ID 629186
Institutional Source Beutler Lab
Gene Symbol AU040320
Ensembl Gene ENSMUSG00000028830
Gene Name expressed sequence AU040320
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8079 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126647331-126763487 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 126725953 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 454 (K454N)
Ref Sequence ENSEMBL: ENSMUSP00000099667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608]
AlphaFold Q8K135
Predicted Effect probably damaging
Transcript: ENSMUST00000047431
AA Change: K454N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830
AA Change: K454N

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102607
AA Change: K454N

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830
AA Change: K454N

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102608
AA Change: K454N

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830
AA Change: K454N

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
PHENOTYPE: Null mice display decreased susceptibility to adenoviral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,221,186 (GRCm39) I255T possibly damaging Het
Ablim1 A T 19: 57,170,656 (GRCm39) probably null Het
Akap10 G A 11: 61,820,880 (GRCm39) P8L possibly damaging Het
Ankle2 C T 5: 110,379,182 (GRCm39) A27V probably damaging Het
Anxa8 A G 14: 33,816,769 (GRCm39) T246A probably benign Het
Arhgap5 A G 12: 52,613,988 (GRCm39) N1460S probably benign Het
Arid5b T G 10: 67,934,186 (GRCm39) D572A possibly damaging Het
Atrn T A 2: 130,855,561 (GRCm39) L1278Q probably null Het
Baz2b T A 2: 59,731,112 (GRCm39) R2085W probably damaging Het
Bbx A T 16: 50,030,821 (GRCm39) N649K probably damaging Het
BC034090 G A 1: 155,101,032 (GRCm39) P411S probably damaging Het
Calcoco2 A T 11: 95,998,363 (GRCm39) F20Y probably damaging Het
Carmil2 A G 8: 106,413,393 (GRCm39) R50G probably damaging Het
Catspere2 A G 1: 177,874,525 (GRCm39) T131A probably benign Het
Cdcp1 C A 9: 123,002,855 (GRCm39) V739L probably damaging Het
Chit1 A G 1: 134,071,765 (GRCm39) T92A possibly damaging Het
Clstn3 A G 6: 124,436,763 (GRCm39) I185T probably damaging Het
Dctpp1 C A 7: 126,858,561 (GRCm39) V61L probably damaging Het
Dip2a T C 10: 76,123,155 (GRCm39) T760A probably benign Het
Dock10 C T 1: 80,556,421 (GRCm39) V552I probably benign Het
Dpp8 A G 9: 64,951,017 (GRCm39) E151G probably damaging Het
Dvl2 G C 11: 69,898,344 (GRCm39) R367P possibly damaging Het
Fem1b A T 9: 62,703,643 (GRCm39) I539N probably damaging Het
Frat2 A T 19: 41,836,277 (GRCm39) L25H probably damaging Het
Garnl3 A T 2: 32,908,511 (GRCm39) probably null Het
Gh T C 11: 106,192,253 (GRCm39) H47R possibly damaging Het
Glmp T C 3: 88,233,045 (GRCm39) V61A probably damaging Het
Gm9925 T C 18: 74,198,558 (GRCm39) V129A unknown Het
H2-M9 T A 17: 36,953,025 (GRCm39) E94V probably benign Het
Hira A T 16: 18,744,507 (GRCm39) Q408L probably benign Het
Hook3 A G 8: 26,578,086 (GRCm39) probably null Het
Ifi206 G A 1: 173,308,724 (GRCm39) P424L Het
Impdh2 T C 9: 108,440,524 (GRCm39) V270A probably benign Het
Klhl14 A G 18: 21,785,022 (GRCm39) I135T probably benign Het
Klra10 C A 6: 130,252,738 (GRCm39) V179L probably benign Het
Kmt2c T C 5: 25,507,730 (GRCm39) S3236G probably damaging Het
Krt76 G T 15: 101,796,825 (GRCm39) A358D possibly damaging Het
Lacc1 C A 14: 77,266,992 (GRCm39) G424C probably damaging Het
Limch1 A G 5: 67,204,096 (GRCm39) I878V possibly damaging Het
Lipi C T 16: 75,362,418 (GRCm39) probably null Het
Lrrc17 C T 5: 21,766,069 (GRCm39) R184W probably damaging Het
Mllt10 A G 2: 18,128,567 (GRCm39) N183D probably damaging Het
Mterf2 C T 10: 84,956,027 (GRCm39) G199D probably damaging Het
Mucl3 T C 17: 35,949,084 (GRCm39) T172A unknown Het
Nat8f4 A T 6: 85,877,976 (GRCm39) S182R probably benign Het
Ndrg3 C A 2: 156,779,452 (GRCm39) E238* probably null Het
Nop14 A T 5: 34,811,805 (GRCm39) L194H probably damaging Het
Obscn T C 11: 58,972,731 (GRCm39) E2105G possibly damaging Het
Or5b104 A C 19: 13,072,648 (GRCm39) Y121* probably null Het
Or5g9 A T 2: 85,552,387 (GRCm39) T213S probably benign Het
Or7g17 A T 9: 18,768,725 (GRCm39) Y259F possibly damaging Het
Or8k32 T A 2: 86,368,725 (GRCm39) H176L possibly damaging Het
Pbx3 C T 2: 34,068,240 (GRCm39) A320T probably benign Het
Pcdhac2 A T 18: 37,279,197 (GRCm39) S726C probably damaging Het
Pcdhgb2 A G 18: 37,823,816 (GRCm39) D269G probably damaging Het
Pcgf6 A T 19: 47,034,271 (GRCm39) S257T probably damaging Het
Pclo A T 5: 14,590,472 (GRCm39) H924L unknown Het
Per3 T A 4: 151,127,135 (GRCm39) T129S possibly damaging Het
Pi4ka A T 16: 17,120,924 (GRCm39) M1270K Het
Plec G A 15: 76,063,750 (GRCm39) Q2277* probably null Het
Pnma1 T A 12: 84,194,109 (GRCm39) K198M probably damaging Het
Prc1 T A 7: 79,954,515 (GRCm39) F196L possibly damaging Het
Prkcz T C 4: 155,441,962 (GRCm39) T57A probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Robo4 A G 9: 37,313,931 (GRCm39) M61V possibly damaging Het
Rps12 C T 10: 23,661,575 (GRCm39) V79I probably benign Het
Rsph3a A G 17: 8,198,020 (GRCm39) K466E probably benign Het
Scly A T 1: 91,236,089 (GRCm39) I168F probably damaging Het
Setd1a T A 7: 127,384,225 (GRCm39) F359I unknown Het
Sh3tc1 A G 5: 35,864,201 (GRCm39) L662P possibly damaging Het
Slc12a5 T C 2: 164,834,372 (GRCm39) W798R probably damaging Het
Slc16a6 C T 11: 109,364,281 (GRCm39) R13Q unknown Het
Slco1a8 T G 6: 141,933,460 (GRCm39) M462L probably benign Het
Smarcad1 A G 6: 65,029,766 (GRCm39) D118G possibly damaging Het
Sos2 T C 12: 69,653,989 (GRCm39) T788A probably damaging Het
Syvn1 A G 19: 6,098,396 (GRCm39) E75G probably null Het
Thpo T C 16: 20,545,144 (GRCm39) E103G probably benign Het
Trav7d-3 A T 14: 52,982,193 (GRCm39) E78V possibly damaging Het
Uap1 A G 1: 169,986,332 (GRCm39) S217P probably damaging Het
Unc45a T G 7: 79,981,310 (GRCm39) R497S probably damaging Het
Upf1 A G 8: 70,791,534 (GRCm39) probably null Het
Usp47 A T 7: 111,646,177 (GRCm39) K28M probably damaging Het
Wdr72 A C 9: 74,126,054 (GRCm39) T1062P probably damaging Het
Wnt7b A T 15: 85,421,646 (GRCm39) C339S probably damaging Het
Zfp954 G T 7: 7,118,470 (GRCm39) T358K probably benign Het
Zmynd15 G T 11: 70,350,278 (GRCm39) probably benign Het
Other mutations in AU040320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:AU040320 APN 4 126,686,027 (GRCm39) missense probably benign
IGL00835:AU040320 APN 4 126,650,864 (GRCm39) splice site probably null
IGL00964:AU040320 APN 4 126,748,199 (GRCm39) nonsense probably null
IGL00978:AU040320 APN 4 126,722,632 (GRCm39) missense probably benign 0.00
IGL01396:AU040320 APN 4 126,763,171 (GRCm39) intron probably benign
IGL02129:AU040320 APN 4 126,717,485 (GRCm39) missense probably damaging 1.00
IGL02148:AU040320 APN 4 126,733,469 (GRCm39) missense possibly damaging 0.64
IGL02179:AU040320 APN 4 126,729,405 (GRCm39) missense probably benign 0.43
IGL02696:AU040320 APN 4 126,736,380 (GRCm39) missense probably damaging 1.00
PIT4677001:AU040320 UTSW 4 126,686,030 (GRCm39) missense probably benign 0.00
R0063:AU040320 UTSW 4 126,733,465 (GRCm39) missense probably damaging 1.00
R0063:AU040320 UTSW 4 126,733,465 (GRCm39) missense probably damaging 1.00
R0356:AU040320 UTSW 4 126,731,155 (GRCm39) missense probably damaging 1.00
R0865:AU040320 UTSW 4 126,742,677 (GRCm39) missense possibly damaging 0.94
R1165:AU040320 UTSW 4 126,717,433 (GRCm39) splice site probably benign
R1216:AU040320 UTSW 4 126,710,276 (GRCm39) splice site probably benign
R1464:AU040320 UTSW 4 126,685,824 (GRCm39) missense possibly damaging 0.92
R1464:AU040320 UTSW 4 126,685,824 (GRCm39) missense possibly damaging 0.92
R1751:AU040320 UTSW 4 126,734,517 (GRCm39) missense probably damaging 1.00
R1767:AU040320 UTSW 4 126,734,517 (GRCm39) missense probably damaging 1.00
R1900:AU040320 UTSW 4 126,747,073 (GRCm39) splice site probably null
R2173:AU040320 UTSW 4 126,686,069 (GRCm39) missense probably benign 0.02
R2414:AU040320 UTSW 4 126,762,484 (GRCm39) critical splice acceptor site probably null
R4061:AU040320 UTSW 4 126,729,488 (GRCm39) missense probably damaging 1.00
R4354:AU040320 UTSW 4 126,748,192 (GRCm39) unclassified probably benign
R4751:AU040320 UTSW 4 126,748,259 (GRCm39) splice site probably null
R4790:AU040320 UTSW 4 126,741,008 (GRCm39) missense possibly damaging 0.62
R4799:AU040320 UTSW 4 126,733,462 (GRCm39) missense probably benign 0.01
R4825:AU040320 UTSW 4 126,685,586 (GRCm39) missense probably damaging 1.00
R4908:AU040320 UTSW 4 126,747,081 (GRCm39) missense probably damaging 1.00
R4914:AU040320 UTSW 4 126,729,469 (GRCm39) nonsense probably null
R5085:AU040320 UTSW 4 126,722,664 (GRCm39) missense possibly damaging 0.83
R5320:AU040320 UTSW 4 126,717,509 (GRCm39) missense possibly damaging 0.52
R5410:AU040320 UTSW 4 126,717,509 (GRCm39) missense possibly damaging 0.52
R5543:AU040320 UTSW 4 126,735,017 (GRCm39) missense probably damaging 1.00
R5684:AU040320 UTSW 4 126,685,939 (GRCm39) missense probably benign 0.06
R5729:AU040320 UTSW 4 126,724,208 (GRCm39) missense probably damaging 1.00
R5918:AU040320 UTSW 4 126,708,064 (GRCm39) missense probably benign 0.32
R6123:AU040320 UTSW 4 126,763,179 (GRCm39) intron probably benign
R6456:AU040320 UTSW 4 126,736,284 (GRCm39) missense probably benign 0.03
R6523:AU040320 UTSW 4 126,762,553 (GRCm39) critical splice donor site probably null
R6591:AU040320 UTSW 4 126,730,463 (GRCm39) missense possibly damaging 0.81
R6603:AU040320 UTSW 4 126,686,046 (GRCm39) missense probably benign 0.02
R6664:AU040320 UTSW 4 126,729,443 (GRCm39) missense probably damaging 1.00
R6691:AU040320 UTSW 4 126,730,463 (GRCm39) missense possibly damaging 0.81
R6864:AU040320 UTSW 4 126,741,612 (GRCm39) missense probably damaging 0.98
R6891:AU040320 UTSW 4 126,740,231 (GRCm39) missense possibly damaging 0.93
R6895:AU040320 UTSW 4 126,685,723 (GRCm39) missense probably damaging 1.00
R7064:AU040320 UTSW 4 126,685,865 (GRCm39) missense probably benign 0.01
R7351:AU040320 UTSW 4 126,710,237 (GRCm39) missense probably damaging 0.98
R7453:AU040320 UTSW 4 126,729,493 (GRCm39) critical splice donor site probably null
R7467:AU040320 UTSW 4 126,708,103 (GRCm39) missense probably benign 0.06
R7492:AU040320 UTSW 4 126,741,648 (GRCm39) missense possibly damaging 0.56
R7513:AU040320 UTSW 4 126,686,057 (GRCm39) missense probably benign 0.01
R7702:AU040320 UTSW 4 126,708,166 (GRCm39) missense probably benign 0.23
R7733:AU040320 UTSW 4 126,729,322 (GRCm39) missense possibly damaging 0.88
R8430:AU040320 UTSW 4 126,742,693 (GRCm39) missense possibly damaging 0.93
R8984:AU040320 UTSW 4 126,734,936 (GRCm39) missense possibly damaging 0.58
R9328:AU040320 UTSW 4 126,729,332 (GRCm39) missense possibly damaging 0.58
R9501:AU040320 UTSW 4 126,735,032 (GRCm39) missense probably benign 0.11
R9721:AU040320 UTSW 4 126,733,441 (GRCm39) missense probably damaging 1.00
Z1177:AU040320 UTSW 4 126,736,426 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGAGCTCTCTGACTGGGAG -3'
(R):5'- CAGACGTGGCTTTTCGAAGGAG -3'

Sequencing Primer
(F):5'- AGCTCTCTGACTGGGAGGTTAG -3'
(R):5'- GTCCTAAGAAGCATCCCTAGTGTG -3'
Posted On 2020-06-30