Incidental Mutation 'R8079:Prkcz'
ID629188
Institutional Source Beutler Lab
Gene Symbol Prkcz
Ensembl Gene ENSMUSG00000029053
Gene Nameprotein kinase C, zeta
SynonymsPkcz, zetaPKC, aPKCzeta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8079 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155260129-155361361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155357505 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 57 (T57A)
Ref Sequence ENSEMBL: ENSMUSP00000030922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030922] [ENSMUST00000105624]
Predicted Effect probably damaging
Transcript: ENSMUST00000030922
AA Change: T57A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030922
Gene: ENSMUSG00000029053
AA Change: T57A

DomainStartEndE-ValueType
PB1 15 98 4.55e-24 SMART
C1 131 180 6.73e-17 SMART
S_TKc 252 518 5.49e-94 SMART
S_TK_X 519 582 2.58e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105624
AA Change: T57A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101249
Gene: ENSMUSG00000029053
AA Change: T57A

DomainStartEndE-ValueType
PB1 15 95 2.39e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Young, not mature, homozygous null mice have reduced B cell numbers and abnormal secondary lymph organ structure. Young mice have fewer Peyer's patches, poor delineation of B & T cell zones, and fewer follicles of small size. Spleens have less prominent B cell follicles and abnormal marginal zones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,083,123 I255T possibly damaging Het
Ablim1 A T 19: 57,182,224 probably null Het
Akap10 G A 11: 61,930,054 P8L possibly damaging Het
Ankle2 C T 5: 110,231,316 A27V probably damaging Het
Anxa8 A G 14: 34,094,812 T246A probably benign Het
Arhgap5 A G 12: 52,567,205 N1460S probably benign Het
Arid5b T G 10: 68,098,356 D572A possibly damaging Het
Atrn T A 2: 131,013,641 L1278Q probably null Het
AU040320 G T 4: 126,832,160 K454N possibly damaging Het
Baz2b T A 2: 59,900,768 R2085W probably damaging Het
Bbx A T 16: 50,210,458 N649K probably damaging Het
BC034090 G A 1: 155,225,286 P411S probably damaging Het
Calcoco2 A T 11: 96,107,537 F20Y probably damaging Het
Carmil2 A G 8: 105,686,761 R50G probably damaging Het
Catspere2 A G 1: 178,046,959 T131A probably benign Het
Cdcp1 C A 9: 123,173,790 V739L probably damaging Het
Chit1 A G 1: 134,144,027 T92A possibly damaging Het
Clstn3 A G 6: 124,459,804 I185T probably damaging Het
Dctpp1 C A 7: 127,259,389 V61L probably damaging Het
Dip2a T C 10: 76,287,321 T760A probably benign Het
Dock10 C T 1: 80,578,704 V552I probably benign Het
Dpcr1 T C 17: 35,638,192 T172A unknown Het
Dpp8 A G 9: 65,043,735 E151G probably damaging Het
Dvl2 G C 11: 70,007,518 R367P possibly damaging Het
Fem1b A T 9: 62,796,361 I539N probably damaging Het
Frat2 A T 19: 41,847,838 L25H probably damaging Het
Garnl3 A T 2: 33,018,499 probably null Het
Gh T C 11: 106,301,427 H47R possibly damaging Het
Glmp T C 3: 88,325,738 V61A probably damaging Het
Gm6614 T G 6: 141,987,734 M462L probably benign Het
Gm9925 T C 18: 74,065,487 V129A unknown Het
H2-M9 T A 17: 36,642,133 E94V probably benign Het
Hira A T 16: 18,925,757 Q408L probably benign Het
Hook3 A G 8: 26,088,058 probably null Het
Ifi206 G A 1: 173,481,158 P424L Het
Impdh2 T C 9: 108,563,325 V270A probably benign Het
Klhl14 A G 18: 21,651,965 I135T probably benign Het
Klra10 C A 6: 130,275,775 V179L probably benign Het
Kmt2c T C 5: 25,302,732 S3236G probably damaging Het
Krt76 G T 15: 101,888,390 A358D possibly damaging Het
Lacc1 C A 14: 77,029,552 G424C probably damaging Het
Limch1 A G 5: 67,046,753 I878V possibly damaging Het
Lipi C T 16: 75,565,530 probably null Het
Lrrc17 C T 5: 21,561,071 R184W probably damaging Het
Mllt10 A G 2: 18,123,756 N183D probably damaging Het
Mterf2 C T 10: 85,120,163 G199D probably damaging Het
Nat8f4 A T 6: 85,900,994 S182R probably benign Het
Ndrg3 C A 2: 156,937,532 E238* probably null Het
Nop14 A T 5: 34,654,461 L194H probably damaging Het
Obscn T C 11: 59,081,905 E2105G possibly damaging Het
Olfr1009 A T 2: 85,722,043 T213S probably benign Het
Olfr1079 T A 2: 86,538,381 H176L possibly damaging Het
Olfr1457 A C 19: 13,095,284 Y121* probably null Het
Olfr829 A T 9: 18,857,429 Y259F possibly damaging Het
Pbx3 C T 2: 34,178,228 A320T probably benign Het
Pcdhac2 A T 18: 37,146,144 S726C probably damaging Het
Pcdhgb2 A G 18: 37,690,763 D269G probably damaging Het
Pcgf6 A T 19: 47,045,832 S257T probably damaging Het
Pclo A T 5: 14,540,458 H924L unknown Het
Per3 T A 4: 151,042,678 T129S possibly damaging Het
Pi4ka A T 16: 17,303,060 M1270K Het
Plec G A 15: 76,179,550 Q2277* probably null Het
Pnma1 T A 12: 84,147,335 K198M probably damaging Het
Prc1 T A 7: 80,304,767 F196L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Robo4 A G 9: 37,402,635 M61V possibly damaging Het
Rps12 C T 10: 23,785,677 V79I probably benign Het
Rsph3a A G 17: 7,979,188 K466E probably benign Het
Scly A T 1: 91,308,367 I168F probably damaging Het
Setd1a T A 7: 127,785,053 F359I unknown Het
Sh3tc1 A G 5: 35,706,857 L662P possibly damaging Het
Slc12a5 T C 2: 164,992,452 W798R probably damaging Het
Slc16a6 C T 11: 109,473,455 R13Q unknown Het
Smarcad1 A G 6: 65,052,782 D118G possibly damaging Het
Sos2 T C 12: 69,607,215 T788A probably damaging Het
Syvn1 A G 19: 6,048,366 E75G probably null Het
Thpo T C 16: 20,726,394 E103G probably benign Het
Trav7d-3 A T 14: 52,744,736 E78V possibly damaging Het
Uap1 A G 1: 170,158,763 S217P probably damaging Het
Unc45a T G 7: 80,331,562 R497S probably damaging Het
Upf1 A G 8: 70,338,884 probably null Het
Usp47 A T 7: 112,046,970 K28M probably damaging Het
Wdr72 A C 9: 74,218,772 T1062P probably damaging Het
Wnt7b A T 15: 85,537,445 C339S probably damaging Het
Zfp954 G T 7: 7,115,471 T358K probably benign Het
Zmynd15 G T 11: 70,459,452 probably benign Het
Other mutations in Prkcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Prkcz APN 4 155294401 splice site probably benign
IGL02114:Prkcz APN 4 155271590 missense probably damaging 1.00
IGL02582:Prkcz APN 4 155271256 missense probably damaging 1.00
IGL03010:Prkcz APN 4 155286805 missense probably damaging 1.00
IGL03199:Prkcz APN 4 155272984 missense possibly damaging 0.85
IGL03225:Prkcz APN 4 155268195 missense probably damaging 0.99
IGL03229:Prkcz APN 4 155262506 missense probably benign 0.19
IGL03299:Prkcz APN 4 155286790 missense possibly damaging 0.78
PIT4403001:Prkcz UTSW 4 155293156 critical splice donor site probably null
R0389:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R0443:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R1666:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1668:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1686:Prkcz UTSW 4 155271256 missense probably damaging 1.00
R1710:Prkcz UTSW 4 155262512 missense probably damaging 1.00
R2025:Prkcz UTSW 4 155289710 missense probably damaging 1.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R4399:Prkcz UTSW 4 155269077 missense possibly damaging 0.86
R4780:Prkcz UTSW 4 155289702 missense probably damaging 1.00
R4923:Prkcz UTSW 4 155357489 missense probably damaging 1.00
R5160:Prkcz UTSW 4 155293232 missense probably benign 0.22
R5510:Prkcz UTSW 4 155272936 splice site probably null
R6278:Prkcz UTSW 4 155268195 missense probably damaging 0.99
R6290:Prkcz UTSW 4 155356499 missense probably damaging 1.00
R6881:Prkcz UTSW 4 155269056 missense possibly damaging 0.90
R7055:Prkcz UTSW 4 155289634 missense probably benign 0.01
R7108:Prkcz UTSW 4 155286793 nonsense probably null
R7241:Prkcz UTSW 4 155269059 missense probably benign 0.00
R7355:Prkcz UTSW 4 155357496 missense probably damaging 1.00
R7466:Prkcz UTSW 4 155271602 missense probably damaging 1.00
R7522:Prkcz UTSW 4 155271285 missense probably damaging 1.00
R7618:Prkcz UTSW 4 155262482 missense probably damaging 1.00
R7753:Prkcz UTSW 4 155272968 missense possibly damaging 0.61
R8407:Prkcz UTSW 4 155268216 missense probably damaging 0.99
R8523:Prkcz UTSW 4 155262511 missense probably damaging 1.00
R8824:Prkcz UTSW 4 155344828 start gained probably benign
X0067:Prkcz UTSW 4 155354704 missense probably benign 0.25
Z1176:Prkcz UTSW 4 155354680 missense probably damaging 1.00
Z1176:Prkcz UTSW 4 155356468 missense probably damaging 1.00
Z1177:Prkcz UTSW 4 155301004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTTGTTCCCCTCAGCTG -3'
(R):5'- AACTTGGCTAAGCAGTGTTTG -3'

Sequencing Primer
(F):5'- GTAGCAGGAACACTCCCCTCTTTTAG -3'
(R):5'- TGGTCACATTCAGATACGATCCAGG -3'
Posted On2020-06-30