Incidental Mutation 'R8079:Limch1'
ID 629194
Institutional Source Beutler Lab
Gene Symbol Limch1
Ensembl Gene ENSMUSG00000037736
Gene Name LIM and calponin homology domains 1
Synonyms 3732412D22Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R8079 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 66903232-67214502 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67204096 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 878 (I878V)
Ref Sequence ENSEMBL: ENSMUSP00000043163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038188] [ENSMUST00000101164] [ENSMUST00000117601] [ENSMUST00000118242] [ENSMUST00000153174]
AlphaFold Q3UH68
Predicted Effect possibly damaging
Transcript: ENSMUST00000038188
AA Change: I878V

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043163
Gene: ENSMUSG00000037736
AA Change: I878V

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
coiled coil region 192 241 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
coiled coil region 615 672 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
LIM 830 888 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101164
AA Change: I1034V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098723
Gene: ENSMUSG00000037736
AA Change: I1034V

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
LIM 986 1044 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117601
AA Change: I875V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113544
Gene: ENSMUSG00000037736
AA Change: I875V

DomainStartEndE-ValueType
CH 23 124 1e-15 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 704 752 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
LIM 910 968 2.4e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118242
AA Change: I1045V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112732
Gene: ENSMUSG00000037736
AA Change: I1045V

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 555 574 N/A INTRINSIC
coiled coil region 782 839 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
LIM 997 1055 5.08e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000112651
Gene: ENSMUSG00000037736
AA Change: I750V

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Pfam:DUF4757 250 418 5.2e-66 PFAM
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
LIM 1012 1070 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153174
AA Change: I37V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118979
Gene: ENSMUSG00000037736
AA Change: I37V

DomainStartEndE-ValueType
Pfam:LIM 1 52 2e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,221,186 (GRCm39) I255T possibly damaging Het
Ablim1 A T 19: 57,170,656 (GRCm39) probably null Het
Akap10 G A 11: 61,820,880 (GRCm39) P8L possibly damaging Het
Ankle2 C T 5: 110,379,182 (GRCm39) A27V probably damaging Het
Anxa8 A G 14: 33,816,769 (GRCm39) T246A probably benign Het
Arhgap5 A G 12: 52,613,988 (GRCm39) N1460S probably benign Het
Arid5b T G 10: 67,934,186 (GRCm39) D572A possibly damaging Het
Atrn T A 2: 130,855,561 (GRCm39) L1278Q probably null Het
AU040320 G T 4: 126,725,953 (GRCm39) K454N possibly damaging Het
Baz2b T A 2: 59,731,112 (GRCm39) R2085W probably damaging Het
Bbx A T 16: 50,030,821 (GRCm39) N649K probably damaging Het
BC034090 G A 1: 155,101,032 (GRCm39) P411S probably damaging Het
Calcoco2 A T 11: 95,998,363 (GRCm39) F20Y probably damaging Het
Carmil2 A G 8: 106,413,393 (GRCm39) R50G probably damaging Het
Catspere2 A G 1: 177,874,525 (GRCm39) T131A probably benign Het
Cdcp1 C A 9: 123,002,855 (GRCm39) V739L probably damaging Het
Chit1 A G 1: 134,071,765 (GRCm39) T92A possibly damaging Het
Clstn3 A G 6: 124,436,763 (GRCm39) I185T probably damaging Het
Dctpp1 C A 7: 126,858,561 (GRCm39) V61L probably damaging Het
Dip2a T C 10: 76,123,155 (GRCm39) T760A probably benign Het
Dock10 C T 1: 80,556,421 (GRCm39) V552I probably benign Het
Dpp8 A G 9: 64,951,017 (GRCm39) E151G probably damaging Het
Dvl2 G C 11: 69,898,344 (GRCm39) R367P possibly damaging Het
Fem1b A T 9: 62,703,643 (GRCm39) I539N probably damaging Het
Frat2 A T 19: 41,836,277 (GRCm39) L25H probably damaging Het
Garnl3 A T 2: 32,908,511 (GRCm39) probably null Het
Gh T C 11: 106,192,253 (GRCm39) H47R possibly damaging Het
Glmp T C 3: 88,233,045 (GRCm39) V61A probably damaging Het
Gm9925 T C 18: 74,198,558 (GRCm39) V129A unknown Het
H2-M9 T A 17: 36,953,025 (GRCm39) E94V probably benign Het
Hira A T 16: 18,744,507 (GRCm39) Q408L probably benign Het
Hook3 A G 8: 26,578,086 (GRCm39) probably null Het
Ifi206 G A 1: 173,308,724 (GRCm39) P424L Het
Impdh2 T C 9: 108,440,524 (GRCm39) V270A probably benign Het
Klhl14 A G 18: 21,785,022 (GRCm39) I135T probably benign Het
Klra10 C A 6: 130,252,738 (GRCm39) V179L probably benign Het
Kmt2c T C 5: 25,507,730 (GRCm39) S3236G probably damaging Het
Krt76 G T 15: 101,796,825 (GRCm39) A358D possibly damaging Het
Lacc1 C A 14: 77,266,992 (GRCm39) G424C probably damaging Het
Lipi C T 16: 75,362,418 (GRCm39) probably null Het
Lrrc17 C T 5: 21,766,069 (GRCm39) R184W probably damaging Het
Mllt10 A G 2: 18,128,567 (GRCm39) N183D probably damaging Het
Mterf2 C T 10: 84,956,027 (GRCm39) G199D probably damaging Het
Mucl3 T C 17: 35,949,084 (GRCm39) T172A unknown Het
Nat8f4 A T 6: 85,877,976 (GRCm39) S182R probably benign Het
Ndrg3 C A 2: 156,779,452 (GRCm39) E238* probably null Het
Nop14 A T 5: 34,811,805 (GRCm39) L194H probably damaging Het
Obscn T C 11: 58,972,731 (GRCm39) E2105G possibly damaging Het
Or5b104 A C 19: 13,072,648 (GRCm39) Y121* probably null Het
Or5g9 A T 2: 85,552,387 (GRCm39) T213S probably benign Het
Or7g17 A T 9: 18,768,725 (GRCm39) Y259F possibly damaging Het
Or8k32 T A 2: 86,368,725 (GRCm39) H176L possibly damaging Het
Pbx3 C T 2: 34,068,240 (GRCm39) A320T probably benign Het
Pcdhac2 A T 18: 37,279,197 (GRCm39) S726C probably damaging Het
Pcdhgb2 A G 18: 37,823,816 (GRCm39) D269G probably damaging Het
Pcgf6 A T 19: 47,034,271 (GRCm39) S257T probably damaging Het
Pclo A T 5: 14,590,472 (GRCm39) H924L unknown Het
Per3 T A 4: 151,127,135 (GRCm39) T129S possibly damaging Het
Pi4ka A T 16: 17,120,924 (GRCm39) M1270K Het
Plec G A 15: 76,063,750 (GRCm39) Q2277* probably null Het
Pnma1 T A 12: 84,194,109 (GRCm39) K198M probably damaging Het
Prc1 T A 7: 79,954,515 (GRCm39) F196L possibly damaging Het
Prkcz T C 4: 155,441,962 (GRCm39) T57A probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Robo4 A G 9: 37,313,931 (GRCm39) M61V possibly damaging Het
Rps12 C T 10: 23,661,575 (GRCm39) V79I probably benign Het
Rsph3a A G 17: 8,198,020 (GRCm39) K466E probably benign Het
Scly A T 1: 91,236,089 (GRCm39) I168F probably damaging Het
Setd1a T A 7: 127,384,225 (GRCm39) F359I unknown Het
Sh3tc1 A G 5: 35,864,201 (GRCm39) L662P possibly damaging Het
Slc12a5 T C 2: 164,834,372 (GRCm39) W798R probably damaging Het
Slc16a6 C T 11: 109,364,281 (GRCm39) R13Q unknown Het
Slco1a8 T G 6: 141,933,460 (GRCm39) M462L probably benign Het
Smarcad1 A G 6: 65,029,766 (GRCm39) D118G possibly damaging Het
Sos2 T C 12: 69,653,989 (GRCm39) T788A probably damaging Het
Syvn1 A G 19: 6,098,396 (GRCm39) E75G probably null Het
Thpo T C 16: 20,545,144 (GRCm39) E103G probably benign Het
Trav7d-3 A T 14: 52,982,193 (GRCm39) E78V possibly damaging Het
Uap1 A G 1: 169,986,332 (GRCm39) S217P probably damaging Het
Unc45a T G 7: 79,981,310 (GRCm39) R497S probably damaging Het
Upf1 A G 8: 70,791,534 (GRCm39) probably null Het
Usp47 A T 7: 111,646,177 (GRCm39) K28M probably damaging Het
Wdr72 A C 9: 74,126,054 (GRCm39) T1062P probably damaging Het
Wnt7b A T 15: 85,421,646 (GRCm39) C339S probably damaging Het
Zfp954 G T 7: 7,118,470 (GRCm39) T358K probably benign Het
Zmynd15 G T 11: 70,350,278 (GRCm39) probably benign Het
Other mutations in Limch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Limch1 APN 5 67,111,022 (GRCm39) missense probably damaging 0.99
IGL00644:Limch1 APN 5 67,173,895 (GRCm39) missense probably benign 0.01
IGL00705:Limch1 APN 5 67,150,496 (GRCm39) nonsense probably null
IGL01154:Limch1 APN 5 66,903,301 (GRCm39) nonsense probably null 0.00
IGL01865:Limch1 APN 5 67,131,923 (GRCm39) nonsense probably null
IGL02529:Limch1 APN 5 67,159,956 (GRCm39) missense possibly damaging 0.89
IGL03171:Limch1 APN 5 67,191,537 (GRCm39) missense possibly damaging 0.80
IGL03308:Limch1 APN 5 67,159,901 (GRCm39) missense possibly damaging 0.92
IGL03396:Limch1 APN 5 67,111,016 (GRCm39) missense probably damaging 1.00
R0067:Limch1 UTSW 5 67,131,965 (GRCm39) missense probably damaging 0.99
R0067:Limch1 UTSW 5 67,131,965 (GRCm39) missense probably damaging 0.99
R0114:Limch1 UTSW 5 67,193,427 (GRCm39) intron probably benign
R0129:Limch1 UTSW 5 67,116,933 (GRCm39) missense probably damaging 0.96
R0193:Limch1 UTSW 5 67,184,882 (GRCm39) missense probably damaging 1.00
R0194:Limch1 UTSW 5 67,156,616 (GRCm39) missense probably benign 0.05
R0367:Limch1 UTSW 5 67,015,297 (GRCm39) critical splice donor site probably null
R0558:Limch1 UTSW 5 67,126,498 (GRCm39) missense probably damaging 1.00
R0927:Limch1 UTSW 5 67,154,576 (GRCm39) missense probably damaging 1.00
R1190:Limch1 UTSW 5 67,126,540 (GRCm39) missense probably damaging 1.00
R1316:Limch1 UTSW 5 67,156,586 (GRCm39) missense probably damaging 1.00
R1469:Limch1 UTSW 5 67,039,323 (GRCm39) splice site probably benign
R1647:Limch1 UTSW 5 67,156,599 (GRCm39) missense probably damaging 1.00
R1648:Limch1 UTSW 5 67,156,599 (GRCm39) missense probably damaging 1.00
R1944:Limch1 UTSW 5 67,156,442 (GRCm39) missense probably damaging 1.00
R2103:Limch1 UTSW 5 67,156,072 (GRCm39) missense probably benign 0.05
R2126:Limch1 UTSW 5 67,187,103 (GRCm39) missense probably damaging 1.00
R2248:Limch1 UTSW 5 67,201,742 (GRCm39) missense probably damaging 1.00
R2415:Limch1 UTSW 5 67,131,977 (GRCm39) missense probably damaging 1.00
R3762:Limch1 UTSW 5 67,186,183 (GRCm39) missense probably damaging 1.00
R3797:Limch1 UTSW 5 67,126,422 (GRCm39) missense probably damaging 1.00
R4659:Limch1 UTSW 5 67,184,900 (GRCm39) missense probably damaging 1.00
R4773:Limch1 UTSW 5 67,184,850 (GRCm39) missense probably damaging 0.99
R4876:Limch1 UTSW 5 67,039,270 (GRCm39) missense possibly damaging 0.64
R5062:Limch1 UTSW 5 67,126,578 (GRCm39) missense probably damaging 1.00
R5191:Limch1 UTSW 5 67,184,904 (GRCm39) missense probably damaging 1.00
R5202:Limch1 UTSW 5 67,150,516 (GRCm39) missense probably damaging 1.00
R5335:Limch1 UTSW 5 67,039,300 (GRCm39) missense probably damaging 1.00
R5436:Limch1 UTSW 5 67,131,909 (GRCm39) missense possibly damaging 0.72
R5994:Limch1 UTSW 5 67,131,965 (GRCm39) missense probably damaging 1.00
R6049:Limch1 UTSW 5 67,188,203 (GRCm39) missense probably benign 0.32
R6228:Limch1 UTSW 5 67,173,845 (GRCm39) missense probably damaging 1.00
R6547:Limch1 UTSW 5 67,186,117 (GRCm39) missense probably damaging 1.00
R6600:Limch1 UTSW 5 66,903,281 (GRCm39) missense probably benign
R6888:Limch1 UTSW 5 67,179,269 (GRCm39) missense probably benign 0.21
R7111:Limch1 UTSW 5 67,182,519 (GRCm39) splice site probably null
R7132:Limch1 UTSW 5 67,111,028 (GRCm39) missense probably damaging 1.00
R7144:Limch1 UTSW 5 67,175,001 (GRCm39) missense probably benign 0.10
R7302:Limch1 UTSW 5 67,116,942 (GRCm39) missense probably benign 0.02
R7341:Limch1 UTSW 5 67,191,545 (GRCm39) missense probably benign 0.06
R7491:Limch1 UTSW 5 67,211,580 (GRCm39) missense probably damaging 0.99
R8229:Limch1 UTSW 5 67,186,138 (GRCm39) missense probably damaging 1.00
R8348:Limch1 UTSW 5 67,159,825 (GRCm39) missense probably damaging 0.98
R8395:Limch1 UTSW 5 67,126,394 (GRCm39) missense probably damaging 0.96
R8416:Limch1 UTSW 5 67,156,649 (GRCm39) missense probably benign
R8448:Limch1 UTSW 5 67,159,825 (GRCm39) missense probably damaging 0.98
R8477:Limch1 UTSW 5 67,131,908 (GRCm39) missense probably benign 0.01
R8924:Limch1 UTSW 5 67,190,475 (GRCm39) missense probably benign 0.01
R9080:Limch1 UTSW 5 67,174,992 (GRCm39) missense probably benign 0.00
R9619:Limch1 UTSW 5 67,015,284 (GRCm39) missense probably damaging 1.00
R9681:Limch1 UTSW 5 67,126,422 (GRCm39) missense probably damaging 1.00
R9715:Limch1 UTSW 5 67,156,360 (GRCm39) missense probably damaging 1.00
X0022:Limch1 UTSW 5 67,179,295 (GRCm39) missense probably benign 0.00
X0027:Limch1 UTSW 5 67,159,963 (GRCm39) missense probably damaging 1.00
Z1177:Limch1 UTSW 5 67,186,142 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTGTACCCCTGTTTGGCTC -3'
(R):5'- AAGAAGCAGCTGGTTGTTGG -3'

Sequencing Primer
(F):5'- GTACTGTATATCCTGAACCACGGG -3'
(R):5'- GGCTTTGTATTTTCTTTGACAGCC -3'
Posted On 2020-06-30