Incidental Mutation 'R8079:Ankle2'
ID 629195
Institutional Source Beutler Lab
Gene Symbol Ankle2
Ensembl Gene ENSMUSG00000029501
Gene Name ankyrin repeat and LEM domain containing 2
Synonyms 1110001J12Rik, D5Ertd585e
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R8079 (G1)
Quality Score 169.009
Status Not validated
Chromosome 5
Chromosomal Location 110378870-110404517 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110379182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 27 (A27V)
Ref Sequence ENSEMBL: ENSMUSP00000143044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031474] [ENSMUST00000086674] [ENSMUST00000112512] [ENSMUST00000197188]
AlphaFold Q6P1H6
Predicted Effect probably damaging
Transcript: ENSMUST00000031474
AA Change: A27V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031474
Gene: ENSMUSG00000029501
AA Change: A27V

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 74 112 6.6e-12 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 923 937 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086674
AA Change: A27V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083878
Gene: ENSMUSG00000029501
AA Change: A27V

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 75 114 5.8e-9 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 845 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197188
AA Change: A27V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143044
Gene: ENSMUSG00000029501
AA Change: A27V

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 75 114 6.4e-9 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 923 937 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LEM family of inner nuclear membrane proteins. The encoded protein functions as a mitotic regulator through postmitotic formation of the nuclear envelope. Mutations in this gene cause morphology defects in the nuclear envelope and BAF hyperphosphorylation. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,221,186 (GRCm39) I255T possibly damaging Het
Ablim1 A T 19: 57,170,656 (GRCm39) probably null Het
Akap10 G A 11: 61,820,880 (GRCm39) P8L possibly damaging Het
Anxa8 A G 14: 33,816,769 (GRCm39) T246A probably benign Het
Arhgap5 A G 12: 52,613,988 (GRCm39) N1460S probably benign Het
Arid5b T G 10: 67,934,186 (GRCm39) D572A possibly damaging Het
Atrn T A 2: 130,855,561 (GRCm39) L1278Q probably null Het
AU040320 G T 4: 126,725,953 (GRCm39) K454N possibly damaging Het
Baz2b T A 2: 59,731,112 (GRCm39) R2085W probably damaging Het
Bbx A T 16: 50,030,821 (GRCm39) N649K probably damaging Het
BC034090 G A 1: 155,101,032 (GRCm39) P411S probably damaging Het
Calcoco2 A T 11: 95,998,363 (GRCm39) F20Y probably damaging Het
Carmil2 A G 8: 106,413,393 (GRCm39) R50G probably damaging Het
Catspere2 A G 1: 177,874,525 (GRCm39) T131A probably benign Het
Cdcp1 C A 9: 123,002,855 (GRCm39) V739L probably damaging Het
Chit1 A G 1: 134,071,765 (GRCm39) T92A possibly damaging Het
Clstn3 A G 6: 124,436,763 (GRCm39) I185T probably damaging Het
Dctpp1 C A 7: 126,858,561 (GRCm39) V61L probably damaging Het
Dip2a T C 10: 76,123,155 (GRCm39) T760A probably benign Het
Dock10 C T 1: 80,556,421 (GRCm39) V552I probably benign Het
Dpp8 A G 9: 64,951,017 (GRCm39) E151G probably damaging Het
Dvl2 G C 11: 69,898,344 (GRCm39) R367P possibly damaging Het
Fem1b A T 9: 62,703,643 (GRCm39) I539N probably damaging Het
Frat2 A T 19: 41,836,277 (GRCm39) L25H probably damaging Het
Garnl3 A T 2: 32,908,511 (GRCm39) probably null Het
Gh T C 11: 106,192,253 (GRCm39) H47R possibly damaging Het
Glmp T C 3: 88,233,045 (GRCm39) V61A probably damaging Het
Gm9925 T C 18: 74,198,558 (GRCm39) V129A unknown Het
H2-M9 T A 17: 36,953,025 (GRCm39) E94V probably benign Het
Hira A T 16: 18,744,507 (GRCm39) Q408L probably benign Het
Hook3 A G 8: 26,578,086 (GRCm39) probably null Het
Ifi206 G A 1: 173,308,724 (GRCm39) P424L Het
Impdh2 T C 9: 108,440,524 (GRCm39) V270A probably benign Het
Klhl14 A G 18: 21,785,022 (GRCm39) I135T probably benign Het
Klra10 C A 6: 130,252,738 (GRCm39) V179L probably benign Het
Kmt2c T C 5: 25,507,730 (GRCm39) S3236G probably damaging Het
Krt76 G T 15: 101,796,825 (GRCm39) A358D possibly damaging Het
Lacc1 C A 14: 77,266,992 (GRCm39) G424C probably damaging Het
Limch1 A G 5: 67,204,096 (GRCm39) I878V possibly damaging Het
Lipi C T 16: 75,362,418 (GRCm39) probably null Het
Lrrc17 C T 5: 21,766,069 (GRCm39) R184W probably damaging Het
Mllt10 A G 2: 18,128,567 (GRCm39) N183D probably damaging Het
Mterf2 C T 10: 84,956,027 (GRCm39) G199D probably damaging Het
Mucl3 T C 17: 35,949,084 (GRCm39) T172A unknown Het
Nat8f4 A T 6: 85,877,976 (GRCm39) S182R probably benign Het
Ndrg3 C A 2: 156,779,452 (GRCm39) E238* probably null Het
Nop14 A T 5: 34,811,805 (GRCm39) L194H probably damaging Het
Obscn T C 11: 58,972,731 (GRCm39) E2105G possibly damaging Het
Or5b104 A C 19: 13,072,648 (GRCm39) Y121* probably null Het
Or5g9 A T 2: 85,552,387 (GRCm39) T213S probably benign Het
Or7g17 A T 9: 18,768,725 (GRCm39) Y259F possibly damaging Het
Or8k32 T A 2: 86,368,725 (GRCm39) H176L possibly damaging Het
Pbx3 C T 2: 34,068,240 (GRCm39) A320T probably benign Het
Pcdhac2 A T 18: 37,279,197 (GRCm39) S726C probably damaging Het
Pcdhgb2 A G 18: 37,823,816 (GRCm39) D269G probably damaging Het
Pcgf6 A T 19: 47,034,271 (GRCm39) S257T probably damaging Het
Pclo A T 5: 14,590,472 (GRCm39) H924L unknown Het
Per3 T A 4: 151,127,135 (GRCm39) T129S possibly damaging Het
Pi4ka A T 16: 17,120,924 (GRCm39) M1270K Het
Plec G A 15: 76,063,750 (GRCm39) Q2277* probably null Het
Pnma1 T A 12: 84,194,109 (GRCm39) K198M probably damaging Het
Prc1 T A 7: 79,954,515 (GRCm39) F196L possibly damaging Het
Prkcz T C 4: 155,441,962 (GRCm39) T57A probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Robo4 A G 9: 37,313,931 (GRCm39) M61V possibly damaging Het
Rps12 C T 10: 23,661,575 (GRCm39) V79I probably benign Het
Rsph3a A G 17: 8,198,020 (GRCm39) K466E probably benign Het
Scly A T 1: 91,236,089 (GRCm39) I168F probably damaging Het
Setd1a T A 7: 127,384,225 (GRCm39) F359I unknown Het
Sh3tc1 A G 5: 35,864,201 (GRCm39) L662P possibly damaging Het
Slc12a5 T C 2: 164,834,372 (GRCm39) W798R probably damaging Het
Slc16a6 C T 11: 109,364,281 (GRCm39) R13Q unknown Het
Slco1a8 T G 6: 141,933,460 (GRCm39) M462L probably benign Het
Smarcad1 A G 6: 65,029,766 (GRCm39) D118G possibly damaging Het
Sos2 T C 12: 69,653,989 (GRCm39) T788A probably damaging Het
Syvn1 A G 19: 6,098,396 (GRCm39) E75G probably null Het
Thpo T C 16: 20,545,144 (GRCm39) E103G probably benign Het
Trav7d-3 A T 14: 52,982,193 (GRCm39) E78V possibly damaging Het
Uap1 A G 1: 169,986,332 (GRCm39) S217P probably damaging Het
Unc45a T G 7: 79,981,310 (GRCm39) R497S probably damaging Het
Upf1 A G 8: 70,791,534 (GRCm39) probably null Het
Usp47 A T 7: 111,646,177 (GRCm39) K28M probably damaging Het
Wdr72 A C 9: 74,126,054 (GRCm39) T1062P probably damaging Het
Wnt7b A T 15: 85,421,646 (GRCm39) C339S probably damaging Het
Zfp954 G T 7: 7,118,470 (GRCm39) T358K probably benign Het
Zmynd15 G T 11: 70,350,278 (GRCm39) probably benign Het
Other mutations in Ankle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Ankle2 APN 5 110,382,218 (GRCm39) missense probably benign 0.01
IGL03030:Ankle2 APN 5 110,399,476 (GRCm39) missense possibly damaging 0.93
R0107:Ankle2 UTSW 5 110,400,893 (GRCm39) missense probably benign
R0219:Ankle2 UTSW 5 110,399,511 (GRCm39) nonsense probably null
R0288:Ankle2 UTSW 5 110,384,256 (GRCm39) missense probably damaging 0.96
R0511:Ankle2 UTSW 5 110,389,925 (GRCm39) splice site probably benign
R1343:Ankle2 UTSW 5 110,385,832 (GRCm39) missense probably damaging 1.00
R2079:Ankle2 UTSW 5 110,392,371 (GRCm39) missense probably damaging 1.00
R3954:Ankle2 UTSW 5 110,399,541 (GRCm39) missense probably benign 0.00
R4161:Ankle2 UTSW 5 110,382,234 (GRCm39) missense probably benign 0.06
R4196:Ankle2 UTSW 5 110,392,409 (GRCm39) missense possibly damaging 0.81
R4613:Ankle2 UTSW 5 110,379,245 (GRCm39) missense probably benign
R4830:Ankle2 UTSW 5 110,389,879 (GRCm39) missense probably damaging 1.00
R4870:Ankle2 UTSW 5 110,399,344 (GRCm39) splice site probably null
R4946:Ankle2 UTSW 5 110,401,704 (GRCm39) missense probably benign 0.06
R5537:Ankle2 UTSW 5 110,397,361 (GRCm39) missense probably damaging 1.00
R5798:Ankle2 UTSW 5 110,399,401 (GRCm39) missense probably damaging 1.00
R5809:Ankle2 UTSW 5 110,385,856 (GRCm39) missense probably damaging 0.99
R6434:Ankle2 UTSW 5 110,401,759 (GRCm39) missense probably damaging 1.00
R6825:Ankle2 UTSW 5 110,398,635 (GRCm39) missense probably null 0.78
R7264:Ankle2 UTSW 5 110,385,689 (GRCm39) missense probably damaging 1.00
R7296:Ankle2 UTSW 5 110,385,590 (GRCm39) missense probably damaging 1.00
R7318:Ankle2 UTSW 5 110,385,632 (GRCm39) missense probably benign 0.19
R7429:Ankle2 UTSW 5 110,382,384 (GRCm39) missense possibly damaging 0.86
R8035:Ankle2 UTSW 5 110,402,318 (GRCm39) missense probably damaging 1.00
R8257:Ankle2 UTSW 5 110,401,781 (GRCm39) critical splice donor site probably null
R8348:Ankle2 UTSW 5 110,389,909 (GRCm39) missense possibly damaging 0.68
R8448:Ankle2 UTSW 5 110,389,909 (GRCm39) missense possibly damaging 0.68
R8478:Ankle2 UTSW 5 110,400,818 (GRCm39) missense possibly damaging 0.92
R8957:Ankle2 UTSW 5 110,379,121 (GRCm39) missense possibly damaging 0.95
R9186:Ankle2 UTSW 5 110,400,610 (GRCm39) missense possibly damaging 0.94
R9187:Ankle2 UTSW 5 110,400,610 (GRCm39) missense possibly damaging 0.94
R9188:Ankle2 UTSW 5 110,400,610 (GRCm39) missense possibly damaging 0.94
R9189:Ankle2 UTSW 5 110,400,610 (GRCm39) missense possibly damaging 0.94
R9617:Ankle2 UTSW 5 110,399,409 (GRCm39) missense probably damaging 1.00
R9651:Ankle2 UTSW 5 110,385,661 (GRCm39) missense probably benign 0.04
X0026:Ankle2 UTSW 5 110,400,986 (GRCm39) missense probably benign 0.01
X0065:Ankle2 UTSW 5 110,384,223 (GRCm39) missense probably damaging 0.99
Z1176:Ankle2 UTSW 5 110,382,365 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGCCTGATCGTTGGGAAACG -3'
(R):5'- ATAGGGTCTTACCGTATCCAGGG -3'

Sequencing Primer
(F):5'- AGCCCGCCTGGTCTAAC -3'
(R):5'- CGTATCCAGGGGGCGTG -3'
Posted On 2020-06-30