Incidental Mutation 'R8079:Repin1'
ID629197
Institutional Source Beutler Lab
Gene Symbol Repin1
Ensembl Gene ENSMUSG00000052751
Gene Namereplication initiator 1
SynonymsZfp464, E430037F08Rik, AP4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8079 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location48593883-48599082 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 48597345 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 403 (E403*)
Ref Sequence ENSEMBL: ENSMUSP00000118890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009420] [ENSMUST00000118229] [ENSMUST00000135151] [ENSMUST00000154010] [ENSMUST00000163452] [ENSMUST00000204095] [ENSMUST00000204121] [ENSMUST00000204521]
Predicted Effect probably null
Transcript: ENSMUST00000009420
AA Change: E347*
SMART Domains Protein: ENSMUSP00000009420
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118229
AA Change: E400*
SMART Domains Protein: ENSMUSP00000113548
Gene: ENSMUSG00000052751
AA Change: E400*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135151
AA Change: E403*
SMART Domains Protein: ENSMUSP00000118890
Gene: ENSMUSG00000052751
AA Change: E403*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
Pfam:zf-C2H2_6 284 300 1.4e-1 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154010
AA Change: E347*
SMART Domains Protein: ENSMUSP00000121975
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163452
AA Change: E347*
SMART Domains Protein: ENSMUSP00000132365
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204095
SMART Domains Protein: ENSMUSP00000145192
Gene: ENSMUSG00000007216

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
ZnF_C2H2 104 126 7.9e-4 SMART
ZnF_C2H2 132 154 1.69e-3 SMART
ZnF_C2H2 160 182 2.36e-2 SMART
ZnF_C2H2 188 210 4.11e-2 SMART
ZnF_C2H2 279 301 1.84e-4 SMART
ZnF_C2H2 307 329 4.94e-5 SMART
ZnF_C2H2 335 357 2.95e-3 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 446 468 1.3e-4 SMART
ZnF_C2H2 474 496 2.12e-4 SMART
ZnF_C2H2 502 524 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204121
Predicted Effect probably benign
Transcript: ENSMUST00000204521
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele improves in insulin sensitivity and glucose metabolism in Leprdb homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,083,123 I255T possibly damaging Het
Ablim1 A T 19: 57,182,224 probably null Het
Akap10 G A 11: 61,930,054 P8L possibly damaging Het
Ankle2 C T 5: 110,231,316 A27V probably damaging Het
Anxa8 A G 14: 34,094,812 T246A probably benign Het
Arhgap5 A G 12: 52,567,205 N1460S probably benign Het
Arid5b T G 10: 68,098,356 D572A possibly damaging Het
Atrn T A 2: 131,013,641 L1278Q probably null Het
AU040320 G T 4: 126,832,160 K454N possibly damaging Het
Baz2b T A 2: 59,900,768 R2085W probably damaging Het
Bbx A T 16: 50,210,458 N649K probably damaging Het
BC034090 G A 1: 155,225,286 P411S probably damaging Het
Calcoco2 A T 11: 96,107,537 F20Y probably damaging Het
Carmil2 A G 8: 105,686,761 R50G probably damaging Het
Catspere2 A G 1: 178,046,959 T131A probably benign Het
Cdcp1 C A 9: 123,173,790 V739L probably damaging Het
Chit1 A G 1: 134,144,027 T92A possibly damaging Het
Clstn3 A G 6: 124,459,804 I185T probably damaging Het
Dctpp1 C A 7: 127,259,389 V61L probably damaging Het
Dip2a T C 10: 76,287,321 T760A probably benign Het
Dock10 C T 1: 80,578,704 V552I probably benign Het
Dpcr1 T C 17: 35,638,192 T172A unknown Het
Dpp8 A G 9: 65,043,735 E151G probably damaging Het
Dvl2 G C 11: 70,007,518 R367P possibly damaging Het
Fem1b A T 9: 62,796,361 I539N probably damaging Het
Frat2 A T 19: 41,847,838 L25H probably damaging Het
Garnl3 A T 2: 33,018,499 probably null Het
Gh T C 11: 106,301,427 H47R possibly damaging Het
Glmp T C 3: 88,325,738 V61A probably damaging Het
Gm6614 T G 6: 141,987,734 M462L probably benign Het
Gm9925 T C 18: 74,065,487 V129A unknown Het
H2-M9 T A 17: 36,642,133 E94V probably benign Het
Hira A T 16: 18,925,757 Q408L probably benign Het
Hook3 A G 8: 26,088,058 probably null Het
Ifi206 G A 1: 173,481,158 P424L Het
Impdh2 T C 9: 108,563,325 V270A probably benign Het
Klhl14 A G 18: 21,651,965 I135T probably benign Het
Klra10 C A 6: 130,275,775 V179L probably benign Het
Kmt2c T C 5: 25,302,732 S3236G probably damaging Het
Krt76 G T 15: 101,888,390 A358D possibly damaging Het
Lacc1 C A 14: 77,029,552 G424C probably damaging Het
Limch1 A G 5: 67,046,753 I878V possibly damaging Het
Lipi C T 16: 75,565,530 probably null Het
Lrrc17 C T 5: 21,561,071 R184W probably damaging Het
Mllt10 A G 2: 18,123,756 N183D probably damaging Het
Mterf2 C T 10: 85,120,163 G199D probably damaging Het
Nat8f4 A T 6: 85,900,994 S182R probably benign Het
Ndrg3 C A 2: 156,937,532 E238* probably null Het
Nop14 A T 5: 34,654,461 L194H probably damaging Het
Obscn T C 11: 59,081,905 E2105G possibly damaging Het
Olfr1009 A T 2: 85,722,043 T213S probably benign Het
Olfr1079 T A 2: 86,538,381 H176L possibly damaging Het
Olfr1457 A C 19: 13,095,284 Y121* probably null Het
Olfr829 A T 9: 18,857,429 Y259F possibly damaging Het
Pbx3 C T 2: 34,178,228 A320T probably benign Het
Pcdhac2 A T 18: 37,146,144 S726C probably damaging Het
Pcdhgb2 A G 18: 37,690,763 D269G probably damaging Het
Pcgf6 A T 19: 47,045,832 S257T probably damaging Het
Pclo A T 5: 14,540,458 H924L unknown Het
Per3 T A 4: 151,042,678 T129S possibly damaging Het
Pi4ka A T 16: 17,303,060 M1270K Het
Plec G A 15: 76,179,550 Q2277* probably null Het
Pnma1 T A 12: 84,147,335 K198M probably damaging Het
Prc1 T A 7: 80,304,767 F196L possibly damaging Het
Prkcz T C 4: 155,357,505 T57A probably damaging Het
Robo4 A G 9: 37,402,635 M61V possibly damaging Het
Rps12 C T 10: 23,785,677 V79I probably benign Het
Rsph3a A G 17: 7,979,188 K466E probably benign Het
Scly A T 1: 91,308,367 I168F probably damaging Het
Setd1a T A 7: 127,785,053 F359I unknown Het
Sh3tc1 A G 5: 35,706,857 L662P possibly damaging Het
Slc12a5 T C 2: 164,992,452 W798R probably damaging Het
Slc16a6 C T 11: 109,473,455 R13Q unknown Het
Smarcad1 A G 6: 65,052,782 D118G possibly damaging Het
Sos2 T C 12: 69,607,215 T788A probably damaging Het
Syvn1 A G 19: 6,048,366 E75G probably null Het
Thpo T C 16: 20,726,394 E103G probably benign Het
Trav7d-3 A T 14: 52,744,736 E78V possibly damaging Het
Uap1 A G 1: 170,158,763 S217P probably damaging Het
Unc45a T G 7: 80,331,562 R497S probably damaging Het
Upf1 A G 8: 70,338,884 probably null Het
Usp47 A T 7: 112,046,970 K28M probably damaging Het
Wdr72 A C 9: 74,218,772 T1062P probably damaging Het
Wnt7b A T 15: 85,537,445 C339S probably damaging Het
Zfp954 G T 7: 7,115,471 T358K probably benign Het
Zmynd15 G T 11: 70,459,452 probably benign Het
Other mutations in Repin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Repin1 APN 6 48596905 missense probably damaging 1.00
IGL01103:Repin1 APN 6 48597953 intron probably benign
IGL02027:Repin1 APN 6 48596473 missense probably damaging 1.00
IGL02143:Repin1 APN 6 48597121 missense probably damaging 1.00
R0395:Repin1 UTSW 6 48597525 missense probably damaging 1.00
R1233:Repin1 UTSW 6 48597834 missense possibly damaging 0.72
R1743:Repin1 UTSW 6 48597750 missense probably damaging 0.96
R2259:Repin1 UTSW 6 48596530 missense probably benign 0.00
R4509:Repin1 UTSW 6 48596526 missense possibly damaging 0.77
R5008:Repin1 UTSW 6 48596608 missense probably damaging 1.00
R5009:Repin1 UTSW 6 48594845 intron probably benign
R5425:Repin1 UTSW 6 48596431 missense probably benign 0.18
R5829:Repin1 UTSW 6 48594832 intron probably benign
R6350:Repin1 UTSW 6 48597628 missense probably damaging 0.98
R6841:Repin1 UTSW 6 48597925 missense possibly damaging 0.95
R6854:Repin1 UTSW 6 48593891 intron probably benign
R7067:Repin1 UTSW 6 48597916 nonsense probably null
R7636:Repin1 UTSW 6 48596365 missense probably benign 0.00
R7699:Repin1 UTSW 6 48597822 missense probably damaging 0.96
R7700:Repin1 UTSW 6 48597822 missense probably damaging 0.96
R7747:Repin1 UTSW 6 48597345 nonsense probably null
R7748:Repin1 UTSW 6 48597345 nonsense probably null
R7781:Repin1 UTSW 6 48597345 nonsense probably null
R7815:Repin1 UTSW 6 48597345 nonsense probably null
R7820:Repin1 UTSW 6 48597345 nonsense probably null
R7869:Repin1 UTSW 6 48597345 nonsense probably null
R7988:Repin1 UTSW 6 48597345 nonsense probably null
R7991:Repin1 UTSW 6 48597345 nonsense probably null
R8078:Repin1 UTSW 6 48597345 nonsense probably null
R8080:Repin1 UTSW 6 48597345 nonsense probably null
R8088:Repin1 UTSW 6 48597345 nonsense probably null
R8089:Repin1 UTSW 6 48597345 nonsense probably null
R8130:Repin1 UTSW 6 48597345 nonsense probably null
R8131:Repin1 UTSW 6 48597345 nonsense probably null
R8324:Repin1 UTSW 6 48597345 nonsense probably null
R8325:Repin1 UTSW 6 48597345 nonsense probably null
R8342:Repin1 UTSW 6 48597345 nonsense probably null
R8411:Repin1 UTSW 6 48597345 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATACATACCGGCGAGAAG -3'
(R):5'- CACATAGGGTTTCTCGCCTG -3'

Sequencing Primer
(F):5'- TACCCATGCACCGAGTGTGG -3'
(R):5'- TGGCTGCCCTGTGAGAAAC -3'
Posted On2020-06-30