Incidental Mutation 'R8079:Clstn3'
ID629200
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Namecalsyntenin 3
Synonymsalcadein-beta, Cst-3, CSTN3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8079 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124430759-124464794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124459804 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 185 (I185T)
Ref Sequence ENSEMBL: ENSMUSP00000008297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523] [ENSMUST00000150774]
Predicted Effect probably damaging
Transcript: ENSMUST00000008297
AA Change: I185T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: I185T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112523
AA Change: I148T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: I148T

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150774
SMART Domains Protein: ENSMUSP00000145422
Gene: ENSMUSG00000008153

DomainStartEndE-ValueType
Blast:CA 13 64 4e-31 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,083,123 I255T possibly damaging Het
Ablim1 A T 19: 57,182,224 probably null Het
Akap10 G A 11: 61,930,054 P8L possibly damaging Het
Ankle2 C T 5: 110,231,316 A27V probably damaging Het
Anxa8 A G 14: 34,094,812 T246A probably benign Het
Arhgap5 A G 12: 52,567,205 N1460S probably benign Het
Arid5b T G 10: 68,098,356 D572A possibly damaging Het
Atrn T A 2: 131,013,641 L1278Q probably null Het
AU040320 G T 4: 126,832,160 K454N possibly damaging Het
Baz2b T A 2: 59,900,768 R2085W probably damaging Het
Bbx A T 16: 50,210,458 N649K probably damaging Het
BC034090 G A 1: 155,225,286 P411S probably damaging Het
Calcoco2 A T 11: 96,107,537 F20Y probably damaging Het
Carmil2 A G 8: 105,686,761 R50G probably damaging Het
Catspere2 A G 1: 178,046,959 T131A probably benign Het
Cdcp1 C A 9: 123,173,790 V739L probably damaging Het
Chit1 A G 1: 134,144,027 T92A possibly damaging Het
Dctpp1 C A 7: 127,259,389 V61L probably damaging Het
Dip2a T C 10: 76,287,321 T760A probably benign Het
Dock10 C T 1: 80,578,704 V552I probably benign Het
Dpcr1 T C 17: 35,638,192 T172A unknown Het
Dpp8 A G 9: 65,043,735 E151G probably damaging Het
Dvl2 G C 11: 70,007,518 R367P possibly damaging Het
Fem1b A T 9: 62,796,361 I539N probably damaging Het
Frat2 A T 19: 41,847,838 L25H probably damaging Het
Garnl3 A T 2: 33,018,499 probably null Het
Gh T C 11: 106,301,427 H47R possibly damaging Het
Glmp T C 3: 88,325,738 V61A probably damaging Het
Gm6614 T G 6: 141,987,734 M462L probably benign Het
Gm9925 T C 18: 74,065,487 V129A unknown Het
H2-M9 T A 17: 36,642,133 E94V probably benign Het
Hira A T 16: 18,925,757 Q408L probably benign Het
Hook3 A G 8: 26,088,058 probably null Het
Ifi206 G A 1: 173,481,158 P424L Het
Impdh2 T C 9: 108,563,325 V270A probably benign Het
Klhl14 A G 18: 21,651,965 I135T probably benign Het
Klra10 C A 6: 130,275,775 V179L probably benign Het
Kmt2c T C 5: 25,302,732 S3236G probably damaging Het
Krt76 G T 15: 101,888,390 A358D possibly damaging Het
Lacc1 C A 14: 77,029,552 G424C probably damaging Het
Limch1 A G 5: 67,046,753 I878V possibly damaging Het
Lipi C T 16: 75,565,530 probably null Het
Lrrc17 C T 5: 21,561,071 R184W probably damaging Het
Mllt10 A G 2: 18,123,756 N183D probably damaging Het
Mterf2 C T 10: 85,120,163 G199D probably damaging Het
Nat8f4 A T 6: 85,900,994 S182R probably benign Het
Ndrg3 C A 2: 156,937,532 E238* probably null Het
Nop14 A T 5: 34,654,461 L194H probably damaging Het
Obscn T C 11: 59,081,905 E2105G possibly damaging Het
Olfr1009 A T 2: 85,722,043 T213S probably benign Het
Olfr1079 T A 2: 86,538,381 H176L possibly damaging Het
Olfr1457 A C 19: 13,095,284 Y121* probably null Het
Olfr829 A T 9: 18,857,429 Y259F possibly damaging Het
Pbx3 C T 2: 34,178,228 A320T probably benign Het
Pcdhac2 A T 18: 37,146,144 S726C probably damaging Het
Pcdhgb2 A G 18: 37,690,763 D269G probably damaging Het
Pcgf6 A T 19: 47,045,832 S257T probably damaging Het
Pclo A T 5: 14,540,458 H924L unknown Het
Per3 T A 4: 151,042,678 T129S possibly damaging Het
Pi4ka A T 16: 17,303,060 M1270K Het
Plec G A 15: 76,179,550 Q2277* probably null Het
Pnma1 T A 12: 84,147,335 K198M probably damaging Het
Prc1 T A 7: 80,304,767 F196L possibly damaging Het
Prkcz T C 4: 155,357,505 T57A probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Robo4 A G 9: 37,402,635 M61V possibly damaging Het
Rps12 C T 10: 23,785,677 V79I probably benign Het
Rsph3a A G 17: 7,979,188 K466E probably benign Het
Scly A T 1: 91,308,367 I168F probably damaging Het
Setd1a T A 7: 127,785,053 F359I unknown Het
Sh3tc1 A G 5: 35,706,857 L662P possibly damaging Het
Slc12a5 T C 2: 164,992,452 W798R probably damaging Het
Slc16a6 C T 11: 109,473,455 R13Q unknown Het
Smarcad1 A G 6: 65,052,782 D118G possibly damaging Het
Sos2 T C 12: 69,607,215 T788A probably damaging Het
Syvn1 A G 19: 6,048,366 E75G probably null Het
Thpo T C 16: 20,726,394 E103G probably benign Het
Trav7d-3 A T 14: 52,744,736 E78V possibly damaging Het
Uap1 A G 1: 170,158,763 S217P probably damaging Het
Unc45a T G 7: 80,331,562 R497S probably damaging Het
Upf1 A G 8: 70,338,884 probably null Het
Usp47 A T 7: 112,046,970 K28M probably damaging Het
Wdr72 A C 9: 74,218,772 T1062P probably damaging Het
Wnt7b A T 15: 85,537,445 C339S probably damaging Het
Zfp954 G T 7: 7,115,471 T358K probably benign Het
Zmynd15 G T 11: 70,459,452 probably benign Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124462139 missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124438822 nonsense probably null
IGL01521:Clstn3 APN 6 124458031 nonsense probably null
IGL01537:Clstn3 APN 6 124431600 missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124449794 missense probably benign 0.06
IGL01879:Clstn3 APN 6 124438810 missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124458663 missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124459263 missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124438368 missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124458023 missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124432169 splice site probably benign
R0276:Clstn3 UTSW 6 124431740 splice site probably benign
R0440:Clstn3 UTSW 6 124451413 missense probably damaging 1.00
R0612:Clstn3 UTSW 6 124449500 missense probably damaging 0.98
R1200:Clstn3 UTSW 6 124459170 missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124457919 missense probably benign
R1378:Clstn3 UTSW 6 124438419 missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124437490 missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124449917 missense probably benign 0.00
R1511:Clstn3 UTSW 6 124462169 missense probably damaging 1.00
R1655:Clstn3 UTSW 6 124437427 missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124431632 missense probably benign 0.04
R1734:Clstn3 UTSW 6 124436814 splice site probably benign
R1751:Clstn3 UTSW 6 124431999 missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124459298 missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124449503 missense probably benign
R2192:Clstn3 UTSW 6 124459207 missense probably damaging 1.00
R2314:Clstn3 UTSW 6 124450717 missense probably benign 0.39
R2874:Clstn3 UTSW 6 124438335 missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124431711 missense probably benign 0.01
R3761:Clstn3 UTSW 6 124457876 missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124451368 missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3935:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124449833 missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124456980 missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124459220 missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124437372 splice site probably null
R4834:Clstn3 UTSW 6 124431953 splice site probably null
R5921:Clstn3 UTSW 6 124431580 utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124438332 missense probably benign 0.01
R6025:Clstn3 UTSW 6 124431664 missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124461670 missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124438429 missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124450704 critical splice donor site probably null
R6813:Clstn3 UTSW 6 124436935 missense probably benign 0.00
R7380:Clstn3 UTSW 6 124456989 missense probably benign 0.01
R7419:Clstn3 UTSW 6 124458129 missense probably benign 0.05
R7625:Clstn3 UTSW 6 124437418 nonsense probably null
R7780:Clstn3 UTSW 6 124462202 missense probably damaging 0.98
R7936:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R7939:Clstn3 UTSW 6 124462199 missense probably damaging 1.00
R8047:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R8085:Clstn3 UTSW 6 124458724 missense probably benign 0.23
R8299:Clstn3 UTSW 6 124437373 critical splice donor site probably null
R8406:Clstn3 UTSW 6 124462177 missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124459266 nonsense probably null
X0066:Clstn3 UTSW 6 124449811 missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124459200 missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124449781 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGCACATACAGATAAGCAGCC -3'
(R):5'- TTCTGCTCCTATGCGTGCAG -3'

Sequencing Primer
(F):5'- CATACAGATAAGCAGCCTAAAGTG -3'
(R):5'- TATGCGTGCAGGGCAAC -3'
Posted On2020-06-30