Mutagenetix > Incidental Mutation

Incidental Mutation 'R8079:Hook3'

629209

Institutional Source

Beutler Lab

Gene Symbol

Hook3

Ensembl Gene

ENSMUSG00000037234

Gene Name

hook microtubule tethering protein 3

Synonyms

E330005F07Rik, 5830454D03Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8079 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

26021421-26119224 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 26088058 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000037182]

AlphaFold

Q8BUK6

Predicted Effect

probably null
Transcript: ENSMUST00000037182

SMART Domains

Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234

Domain	Start	End	E-Value	Type
Pfam:HOOK	12	710	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000037182

SMART Domains

Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234

Domain	Start	End	E-Value	Type
Pfam:HOOK	12	710	N/A	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 96.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	A	G	5: 124,083,123	I255T	possibly damaging	Het
Ablim1	A	T	19: 57,182,224		probably null	Het
Akap10	G	A	11: 61,930,054	P8L	possibly damaging	Het
Ankle2	C	T	5: 110,231,316	A27V	probably damaging	Het
Anxa8	A	G	14: 34,094,812	T246A	probably benign	Het
Arhgap5	A	G	12: 52,567,205	N1460S	probably benign	Het
Arid5b	T	G	10: 68,098,356	D572A	possibly damaging	Het
Atrn	T	A	2: 131,013,641	L1278Q	probably null	Het
AU040320	G	T	4: 126,832,160	K454N	possibly damaging	Het
Baz2b	T	A	2: 59,900,768	R2085W	probably damaging	Het
Bbx	A	T	16: 50,210,458	N649K	probably damaging	Het
BC034090	G	A	1: 155,225,286	P411S	probably damaging	Het
Calcoco2	A	T	11: 96,107,537	F20Y	probably damaging	Het
Carmil2	A	G	8: 105,686,761	R50G	probably damaging	Het
Catspere2	A	G	1: 178,046,959	T131A	probably benign	Het
Cdcp1	C	A	9: 123,173,790	V739L	probably damaging	Het
Chit1	A	G	1: 134,144,027	T92A	possibly damaging	Het
Clstn3	A	G	6: 124,459,804	I185T	probably damaging	Het
Dctpp1	C	A	7: 127,259,389	V61L	probably damaging	Het
Dip2a	T	C	10: 76,287,321	T760A	probably benign	Het
Dock10	C	T	1: 80,578,704	V552I	probably benign	Het
Dpcr1	T	C	17: 35,638,192	T172A	unknown	Het
Dpp8	A	G	9: 65,043,735	E151G	probably damaging	Het
Dvl2	G	C	11: 70,007,518	R367P	possibly damaging	Het
Fem1b	A	T	9: 62,796,361	I539N	probably damaging	Het
Frat2	A	T	19: 41,847,838	L25H	probably damaging	Het
Garnl3	A	T	2: 33,018,499		probably null	Het
Gh	T	C	11: 106,301,427	H47R	possibly damaging	Het
Glmp	T	C	3: 88,325,738	V61A	probably damaging	Het
Gm6614	T	G	6: 141,987,734	M462L	probably benign	Het
Gm9925	T	C	18: 74,065,487	V129A	unknown	Het
H2-M9	T	A	17: 36,642,133	E94V	probably benign	Het
Hira	A	T	16: 18,925,757	Q408L	probably benign	Het
Ifi206	G	A	1: 173,481,158	P424L		Het
Impdh2	T	C	9: 108,563,325	V270A	probably benign	Het
Klhl14	A	G	18: 21,651,965	I135T	probably benign	Het
Klra10	C	A	6: 130,275,775	V179L	probably benign	Het
Kmt2c	T	C	5: 25,302,732	S3236G	probably damaging	Het
Krt76	G	T	15: 101,888,390	A358D	possibly damaging	Het
Lacc1	C	A	14: 77,029,552	G424C	probably damaging	Het
Limch1	A	G	5: 67,046,753	I878V	possibly damaging	Het
Lipi	C	T	16: 75,565,530		probably null	Het
Lrrc17	C	T	5: 21,561,071	R184W	probably damaging	Het
Mllt10	A	G	2: 18,123,756	N183D	probably damaging	Het
Mterf2	C	T	10: 85,120,163	G199D	probably damaging	Het
Nat8f4	A	T	6: 85,900,994	S182R	probably benign	Het
Ndrg3	C	A	2: 156,937,532	E238*	probably null	Het
Nop14	A	T	5: 34,654,461	L194H	probably damaging	Het
Obscn	T	C	11: 59,081,905	E2105G	possibly damaging	Het
Olfr1009	A	T	2: 85,722,043	T213S	probably benign	Het
Olfr1079	T	A	2: 86,538,381	H176L	possibly damaging	Het
Olfr1457	A	C	19: 13,095,284	Y121*	probably null	Het
Olfr829	A	T	9: 18,857,429	Y259F	possibly damaging	Het
Pbx3	C	T	2: 34,178,228	A320T	probably benign	Het
Pcdhac2	A	T	18: 37,146,144	S726C	probably damaging	Het
Pcdhgb2	A	G	18: 37,690,763	D269G	probably damaging	Het
Pcgf6	A	T	19: 47,045,832	S257T	probably damaging	Het
Pclo	A	T	5: 14,540,458	H924L	unknown	Het
Per3	T	A	4: 151,042,678	T129S	possibly damaging	Het
Pi4ka	A	T	16: 17,303,060	M1270K		Het
Plec	G	A	15: 76,179,550	Q2277*	probably null	Het
Pnma1	T	A	12: 84,147,335	K198M	probably damaging	Het
Prc1	T	A	7: 80,304,767	F196L	possibly damaging	Het
Prkcz	T	C	4: 155,357,505	T57A	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Robo4	A	G	9: 37,402,635	M61V	possibly damaging	Het
Rps12	C	T	10: 23,785,677	V79I	probably benign	Het
Rsph3a	A	G	17: 7,979,188	K466E	probably benign	Het
Scly	A	T	1: 91,308,367	I168F	probably damaging	Het
Setd1a	T	A	7: 127,785,053	F359I	unknown	Het
Sh3tc1	A	G	5: 35,706,857	L662P	possibly damaging	Het
Slc12a5	T	C	2: 164,992,452	W798R	probably damaging	Het
Slc16a6	C	T	11: 109,473,455	R13Q	unknown	Het
Smarcad1	A	G	6: 65,052,782	D118G	possibly damaging	Het
Sos2	T	C	12: 69,607,215	T788A	probably damaging	Het
Syvn1	A	G	19: 6,048,366	E75G	probably null	Het
Thpo	T	C	16: 20,726,394	E103G	probably benign	Het
Trav7d-3	A	T	14: 52,744,736	E78V	possibly damaging	Het
Uap1	A	G	1: 170,158,763	S217P	probably damaging	Het
Unc45a	T	G	7: 80,331,562	R497S	probably damaging	Het
Upf1	A	G	8: 70,338,884		probably null	Het
Usp47	A	T	7: 112,046,970	K28M	probably damaging	Het
Wdr72	A	C	9: 74,218,772	T1062P	probably damaging	Het
Wnt7b	A	T	15: 85,537,445	C339S	probably damaging	Het
Zfp954	G	T	7: 7,115,471	T358K	probably benign	Het
Zmynd15	G	T	11: 70,459,452		probably benign	Het

Other mutations in Hook3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Hook3	APN	8	26059250	missense	possibly damaging	0.46
IGL01066:Hook3	APN	8	26048298	missense	probably damaging	1.00
IGL01145:Hook3	APN	8	26059344	missense	probably benign	0.00
IGL01514:Hook3	APN	8	26088189	missense	possibly damaging	0.69
IGL01727:Hook3	APN	8	26070159	missense	probably benign	0.00
IGL01832:Hook3	APN	8	26072365	missense	possibly damaging	0.87
IGL01874:Hook3	APN	8	26039732	missense	possibly damaging	0.71
IGL01931:Hook3	APN	8	26088055	splice site	probably benign
IGL01948:Hook3	APN	8	26059312	missense	possibly damaging	0.95
IGL02209:Hook3	APN	8	26070265	missense	probably damaging	0.99
IGL02675:Hook3	APN	8	26061434	missense	possibly damaging	0.64
IGL02750:Hook3	APN	8	26095754	splice site	probably benign
Rufio	UTSW	8	26034940	nonsense	probably null
R0384:Hook3	UTSW	8	26044235	splice site	probably null
R0600:Hook3	UTSW	8	26118986	missense	probably benign
R1037:Hook3	UTSW	8	26072350	missense	possibly damaging	0.92
R1413:Hook3	UTSW	8	26038106	missense	probably damaging	0.98
R1563:Hook3	UTSW	8	26110752	missense	probably benign	0.06
R1767:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R1806:Hook3	UTSW	8	26068659	missense	probably damaging	1.00
R2025:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2026:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2027:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2091:Hook3	UTSW	8	26059394	splice site	probably benign
R2153:Hook3	UTSW	8	26070197	missense	probably damaging	1.00
R2184:Hook3	UTSW	8	26118983	missense	probably benign	0.00
R4586:Hook3	UTSW	8	26032011	missense	probably damaging	0.98
R4863:Hook3	UTSW	8	26038029	missense	probably damaging	1.00
R4971:Hook3	UTSW	8	26082579	missense	probably benign	0.22
R5023:Hook3	UTSW	8	26032019	frame shift	probably null
R5026:Hook3	UTSW	8	26110757	missense	probably damaging	0.98
R5068:Hook3	UTSW	8	26095757	critical splice donor site	probably null
R5253:Hook3	UTSW	8	26072291	missense	probably benign
R5383:Hook3	UTSW	8	26118989	missense	probably benign	0.01
R5437:Hook3	UTSW	8	26061422	missense	probably benign	0.05
R5528:Hook3	UTSW	8	26072293	missense	probably damaging	1.00
R5551:Hook3	UTSW	8	26068611	missense	possibly damaging	0.75
R5846:Hook3	UTSW	8	26044327	intron	probably benign
R5907:Hook3	UTSW	8	26044278	intron	probably benign
R6082:Hook3	UTSW	8	26110785	missense	probably benign	0.00
R6124:Hook3	UTSW	8	26059272	missense	probably benign	0.20
R6301:Hook3	UTSW	8	26034940	nonsense	probably null
R6314:Hook3	UTSW	8	26088108	missense	probably benign
R6448:Hook3	UTSW	8	26093664	missense	probably benign	0.02
R6810:Hook3	UTSW	8	26032422	splice site	probably null
R7168:Hook3	UTSW	8	26071086	missense	probably benign	0.02
R7856:Hook3	UTSW	8	26035221	missense	probably damaging	1.00
R7988:Hook3	UTSW	8	26073647	missense	probably benign	0.02
R9121:Hook3	UTSW	8	26035167	missense	probably damaging	1.00
R9223:Hook3	UTSW	8	26032524	missense
R9244:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R9246:Hook3	UTSW	8	26072291	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGTTCCACAGCAGCATAAC -3'
(R):5'- CAGCTCTGGTCTTGACACTGAG -3'

Sequencing Primer
(F):5'- GTATGAAACTACCCAATCATACAGC -3'
(R):5'- GAGTCTTTGGTGATAGCAAATTGACC -3'

Posted On

2020-06-30