Mutagenetix > Incidental Mutation

Incidental Mutation 'R8079:Upf1'

629210

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R8079 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 70338884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000075089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000075666] [ENSMUST00000215817] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably null
Transcript: ENSMUST00000075666

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000075666

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000215817

Predicted Effect

probably null
Transcript: ENSMUST00000215817

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 96.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	A	G	5: 124,083,123	I255T	possibly damaging	Het
Ablim1	A	T	19: 57,182,224		probably null	Het
Akap10	G	A	11: 61,930,054	P8L	possibly damaging	Het
Ankle2	C	T	5: 110,231,316	A27V	probably damaging	Het
Anxa8	A	G	14: 34,094,812	T246A	probably benign	Het
Arhgap5	A	G	12: 52,567,205	N1460S	probably benign	Het
Arid5b	T	G	10: 68,098,356	D572A	possibly damaging	Het
Atrn	T	A	2: 131,013,641	L1278Q	probably null	Het
AU040320	G	T	4: 126,832,160	K454N	possibly damaging	Het
Baz2b	T	A	2: 59,900,768	R2085W	probably damaging	Het
Bbx	A	T	16: 50,210,458	N649K	probably damaging	Het
BC034090	G	A	1: 155,225,286	P411S	probably damaging	Het
Calcoco2	A	T	11: 96,107,537	F20Y	probably damaging	Het
Carmil2	A	G	8: 105,686,761	R50G	probably damaging	Het
Catspere2	A	G	1: 178,046,959	T131A	probably benign	Het
Cdcp1	C	A	9: 123,173,790	V739L	probably damaging	Het
Chit1	A	G	1: 134,144,027	T92A	possibly damaging	Het
Clstn3	A	G	6: 124,459,804	I185T	probably damaging	Het
Dctpp1	C	A	7: 127,259,389	V61L	probably damaging	Het
Dip2a	T	C	10: 76,287,321	T760A	probably benign	Het
Dock10	C	T	1: 80,578,704	V552I	probably benign	Het
Dpcr1	T	C	17: 35,638,192	T172A	unknown	Het
Dpp8	A	G	9: 65,043,735	E151G	probably damaging	Het
Dvl2	G	C	11: 70,007,518	R367P	possibly damaging	Het
Fem1b	A	T	9: 62,796,361	I539N	probably damaging	Het
Frat2	A	T	19: 41,847,838	L25H	probably damaging	Het
Garnl3	A	T	2: 33,018,499		probably null	Het
Gh	T	C	11: 106,301,427	H47R	possibly damaging	Het
Glmp	T	C	3: 88,325,738	V61A	probably damaging	Het
Gm6614	T	G	6: 141,987,734	M462L	probably benign	Het
Gm9925	T	C	18: 74,065,487	V129A	unknown	Het
H2-M9	T	A	17: 36,642,133	E94V	probably benign	Het
Hira	A	T	16: 18,925,757	Q408L	probably benign	Het
Hook3	A	G	8: 26,088,058		probably null	Het
Ifi206	G	A	1: 173,481,158	P424L		Het
Impdh2	T	C	9: 108,563,325	V270A	probably benign	Het
Klhl14	A	G	18: 21,651,965	I135T	probably benign	Het
Klra10	C	A	6: 130,275,775	V179L	probably benign	Het
Kmt2c	T	C	5: 25,302,732	S3236G	probably damaging	Het
Krt76	G	T	15: 101,888,390	A358D	possibly damaging	Het
Lacc1	C	A	14: 77,029,552	G424C	probably damaging	Het
Limch1	A	G	5: 67,046,753	I878V	possibly damaging	Het
Lipi	C	T	16: 75,565,530		probably null	Het
Lrrc17	C	T	5: 21,561,071	R184W	probably damaging	Het
Mllt10	A	G	2: 18,123,756	N183D	probably damaging	Het
Mterf2	C	T	10: 85,120,163	G199D	probably damaging	Het
Nat8f4	A	T	6: 85,900,994	S182R	probably benign	Het
Ndrg3	C	A	2: 156,937,532	E238*	probably null	Het
Nop14	A	T	5: 34,654,461	L194H	probably damaging	Het
Obscn	T	C	11: 59,081,905	E2105G	possibly damaging	Het
Olfr1009	A	T	2: 85,722,043	T213S	probably benign	Het
Olfr1079	T	A	2: 86,538,381	H176L	possibly damaging	Het
Olfr1457	A	C	19: 13,095,284	Y121*	probably null	Het
Olfr829	A	T	9: 18,857,429	Y259F	possibly damaging	Het
Pbx3	C	T	2: 34,178,228	A320T	probably benign	Het
Pcdhac2	A	T	18: 37,146,144	S726C	probably damaging	Het
Pcdhgb2	A	G	18: 37,690,763	D269G	probably damaging	Het
Pcgf6	A	T	19: 47,045,832	S257T	probably damaging	Het
Pclo	A	T	5: 14,540,458	H924L	unknown	Het
Per3	T	A	4: 151,042,678	T129S	possibly damaging	Het
Pi4ka	A	T	16: 17,303,060	M1270K		Het
Plec	G	A	15: 76,179,550	Q2277*	probably null	Het
Pnma1	T	A	12: 84,147,335	K198M	probably damaging	Het
Prc1	T	A	7: 80,304,767	F196L	possibly damaging	Het
Prkcz	T	C	4: 155,357,505	T57A	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Robo4	A	G	9: 37,402,635	M61V	possibly damaging	Het
Rps12	C	T	10: 23,785,677	V79I	probably benign	Het
Rsph3a	A	G	17: 7,979,188	K466E	probably benign	Het
Scly	A	T	1: 91,308,367	I168F	probably damaging	Het
Setd1a	T	A	7: 127,785,053	F359I	unknown	Het
Sh3tc1	A	G	5: 35,706,857	L662P	possibly damaging	Het
Slc12a5	T	C	2: 164,992,452	W798R	probably damaging	Het
Slc16a6	C	T	11: 109,473,455	R13Q	unknown	Het
Smarcad1	A	G	6: 65,052,782	D118G	possibly damaging	Het
Sos2	T	C	12: 69,607,215	T788A	probably damaging	Het
Syvn1	A	G	19: 6,048,366	E75G	probably null	Het
Thpo	T	C	16: 20,726,394	E103G	probably benign	Het
Trav7d-3	A	T	14: 52,744,736	E78V	possibly damaging	Het
Uap1	A	G	1: 170,158,763	S217P	probably damaging	Het
Unc45a	T	G	7: 80,331,562	R497S	probably damaging	Het
Usp47	A	T	7: 112,046,970	K28M	probably damaging	Het
Wdr72	A	C	9: 74,218,772	T1062P	probably damaging	Het
Wnt7b	A	T	15: 85,537,445	C339S	probably damaging	Het
Zfp954	G	T	7: 7,115,471	T358K	probably benign	Het
Zmynd15	G	T	11: 70,459,452		probably benign	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCTGTAATAGGCAGGTACAGC -3'
(R):5'- CCACTCTCAGGTGCCATTAG -3'

Sequencing Primer
(F):5'- TCAGCTCAACGGTGACCTC -3'
(R):5'- CTAGGGCCAGGGTCTGTAG -3'

Posted On

2020-06-30