Incidental Mutation 'R8079:Upf1'
ID 629210
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene Name UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms B430202H16Rik, Rent1, PNORF-1
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R8079 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 70784175-70805928 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 70791534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000075666] [ENSMUST00000215817] [ENSMUST00000215817]
AlphaFold Q9EPU0
Predicted Effect probably null
Transcript: ENSMUST00000075666
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075666
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215817
Predicted Effect probably null
Transcript: ENSMUST00000215817
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,221,186 (GRCm39) I255T possibly damaging Het
Ablim1 A T 19: 57,170,656 (GRCm39) probably null Het
Akap10 G A 11: 61,820,880 (GRCm39) P8L possibly damaging Het
Ankle2 C T 5: 110,379,182 (GRCm39) A27V probably damaging Het
Anxa8 A G 14: 33,816,769 (GRCm39) T246A probably benign Het
Arhgap5 A G 12: 52,613,988 (GRCm39) N1460S probably benign Het
Arid5b T G 10: 67,934,186 (GRCm39) D572A possibly damaging Het
Atrn T A 2: 130,855,561 (GRCm39) L1278Q probably null Het
AU040320 G T 4: 126,725,953 (GRCm39) K454N possibly damaging Het
Baz2b T A 2: 59,731,112 (GRCm39) R2085W probably damaging Het
Bbx A T 16: 50,030,821 (GRCm39) N649K probably damaging Het
BC034090 G A 1: 155,101,032 (GRCm39) P411S probably damaging Het
Calcoco2 A T 11: 95,998,363 (GRCm39) F20Y probably damaging Het
Carmil2 A G 8: 106,413,393 (GRCm39) R50G probably damaging Het
Catspere2 A G 1: 177,874,525 (GRCm39) T131A probably benign Het
Cdcp1 C A 9: 123,002,855 (GRCm39) V739L probably damaging Het
Chit1 A G 1: 134,071,765 (GRCm39) T92A possibly damaging Het
Clstn3 A G 6: 124,436,763 (GRCm39) I185T probably damaging Het
Dctpp1 C A 7: 126,858,561 (GRCm39) V61L probably damaging Het
Dip2a T C 10: 76,123,155 (GRCm39) T760A probably benign Het
Dock10 C T 1: 80,556,421 (GRCm39) V552I probably benign Het
Dpp8 A G 9: 64,951,017 (GRCm39) E151G probably damaging Het
Dvl2 G C 11: 69,898,344 (GRCm39) R367P possibly damaging Het
Fem1b A T 9: 62,703,643 (GRCm39) I539N probably damaging Het
Frat2 A T 19: 41,836,277 (GRCm39) L25H probably damaging Het
Garnl3 A T 2: 32,908,511 (GRCm39) probably null Het
Gh T C 11: 106,192,253 (GRCm39) H47R possibly damaging Het
Glmp T C 3: 88,233,045 (GRCm39) V61A probably damaging Het
Gm9925 T C 18: 74,198,558 (GRCm39) V129A unknown Het
H2-M9 T A 17: 36,953,025 (GRCm39) E94V probably benign Het
Hira A T 16: 18,744,507 (GRCm39) Q408L probably benign Het
Hook3 A G 8: 26,578,086 (GRCm39) probably null Het
Ifi206 G A 1: 173,308,724 (GRCm39) P424L Het
Impdh2 T C 9: 108,440,524 (GRCm39) V270A probably benign Het
Klhl14 A G 18: 21,785,022 (GRCm39) I135T probably benign Het
Klra10 C A 6: 130,252,738 (GRCm39) V179L probably benign Het
Kmt2c T C 5: 25,507,730 (GRCm39) S3236G probably damaging Het
Krt76 G T 15: 101,796,825 (GRCm39) A358D possibly damaging Het
Lacc1 C A 14: 77,266,992 (GRCm39) G424C probably damaging Het
Limch1 A G 5: 67,204,096 (GRCm39) I878V possibly damaging Het
Lipi C T 16: 75,362,418 (GRCm39) probably null Het
Lrrc17 C T 5: 21,766,069 (GRCm39) R184W probably damaging Het
Mllt10 A G 2: 18,128,567 (GRCm39) N183D probably damaging Het
Mterf2 C T 10: 84,956,027 (GRCm39) G199D probably damaging Het
Mucl3 T C 17: 35,949,084 (GRCm39) T172A unknown Het
Nat8f4 A T 6: 85,877,976 (GRCm39) S182R probably benign Het
Ndrg3 C A 2: 156,779,452 (GRCm39) E238* probably null Het
Nop14 A T 5: 34,811,805 (GRCm39) L194H probably damaging Het
Obscn T C 11: 58,972,731 (GRCm39) E2105G possibly damaging Het
Or5b104 A C 19: 13,072,648 (GRCm39) Y121* probably null Het
Or5g9 A T 2: 85,552,387 (GRCm39) T213S probably benign Het
Or7g17 A T 9: 18,768,725 (GRCm39) Y259F possibly damaging Het
Or8k32 T A 2: 86,368,725 (GRCm39) H176L possibly damaging Het
Pbx3 C T 2: 34,068,240 (GRCm39) A320T probably benign Het
Pcdhac2 A T 18: 37,279,197 (GRCm39) S726C probably damaging Het
Pcdhgb2 A G 18: 37,823,816 (GRCm39) D269G probably damaging Het
Pcgf6 A T 19: 47,034,271 (GRCm39) S257T probably damaging Het
Pclo A T 5: 14,590,472 (GRCm39) H924L unknown Het
Per3 T A 4: 151,127,135 (GRCm39) T129S possibly damaging Het
Pi4ka A T 16: 17,120,924 (GRCm39) M1270K Het
Plec G A 15: 76,063,750 (GRCm39) Q2277* probably null Het
Pnma1 T A 12: 84,194,109 (GRCm39) K198M probably damaging Het
Prc1 T A 7: 79,954,515 (GRCm39) F196L possibly damaging Het
Prkcz T C 4: 155,441,962 (GRCm39) T57A probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Robo4 A G 9: 37,313,931 (GRCm39) M61V possibly damaging Het
Rps12 C T 10: 23,661,575 (GRCm39) V79I probably benign Het
Rsph3a A G 17: 8,198,020 (GRCm39) K466E probably benign Het
Scly A T 1: 91,236,089 (GRCm39) I168F probably damaging Het
Setd1a T A 7: 127,384,225 (GRCm39) F359I unknown Het
Sh3tc1 A G 5: 35,864,201 (GRCm39) L662P possibly damaging Het
Slc12a5 T C 2: 164,834,372 (GRCm39) W798R probably damaging Het
Slc16a6 C T 11: 109,364,281 (GRCm39) R13Q unknown Het
Slco1a8 T G 6: 141,933,460 (GRCm39) M462L probably benign Het
Smarcad1 A G 6: 65,029,766 (GRCm39) D118G possibly damaging Het
Sos2 T C 12: 69,653,989 (GRCm39) T788A probably damaging Het
Syvn1 A G 19: 6,098,396 (GRCm39) E75G probably null Het
Thpo T C 16: 20,545,144 (GRCm39) E103G probably benign Het
Trav7d-3 A T 14: 52,982,193 (GRCm39) E78V possibly damaging Het
Uap1 A G 1: 169,986,332 (GRCm39) S217P probably damaging Het
Unc45a T G 7: 79,981,310 (GRCm39) R497S probably damaging Het
Usp47 A T 7: 111,646,177 (GRCm39) K28M probably damaging Het
Wdr72 A C 9: 74,126,054 (GRCm39) T1062P probably damaging Het
Wnt7b A T 15: 85,421,646 (GRCm39) C339S probably damaging Het
Zfp954 G T 7: 7,118,470 (GRCm39) T358K probably benign Het
Zmynd15 G T 11: 70,350,278 (GRCm39) probably benign Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70,790,934 (GRCm39) missense probably benign
IGL01890:Upf1 APN 8 70,786,880 (GRCm39) missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70,788,302 (GRCm39) critical splice donor site probably null
IGL03142:Upf1 APN 8 70,785,977 (GRCm39) missense probably benign 0.04
IGL03151:Upf1 APN 8 70,788,037 (GRCm39) missense probably damaging 0.98
Nanosphere UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
Particulate UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R0270:Upf1 UTSW 8 70,788,295 (GRCm39) splice site probably benign
R0477:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R0755:Upf1 UTSW 8 70,786,779 (GRCm39) missense probably benign 0.01
R1018:Upf1 UTSW 8 70,791,556 (GRCm39) missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70,791,053 (GRCm39) missense probably damaging 0.98
R1445:Upf1 UTSW 8 70,794,174 (GRCm39) missense probably benign 0.00
R1458:Upf1 UTSW 8 70,796,904 (GRCm39) missense probably benign 0.00
R1511:Upf1 UTSW 8 70,791,155 (GRCm39) missense probably damaging 0.99
R1552:Upf1 UTSW 8 70,785,709 (GRCm39) nonsense probably null
R1560:Upf1 UTSW 8 70,791,092 (GRCm39) missense probably damaging 1.00
R1562:Upf1 UTSW 8 70,796,017 (GRCm39) nonsense probably null
R2082:Upf1 UTSW 8 70,794,222 (GRCm39) missense probably damaging 1.00
R2143:Upf1 UTSW 8 70,792,004 (GRCm39) missense probably null 1.00
R2423:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R2425:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3031:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3032:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3123:Upf1 UTSW 8 70,790,133 (GRCm39) splice site probably benign
R3508:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3747:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70,792,464 (GRCm39) missense probably benign 0.30
R3964:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3965:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4152:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4505:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4506:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4838:Upf1 UTSW 8 70,792,018 (GRCm39) missense probably benign 0.03
R5001:Upf1 UTSW 8 70,787,350 (GRCm39) missense probably damaging 1.00
R5715:Upf1 UTSW 8 70,805,628 (GRCm39) missense probably damaging 0.96
R5748:Upf1 UTSW 8 70,791,167 (GRCm39) missense probably damaging 1.00
R5856:Upf1 UTSW 8 70,787,412 (GRCm39) critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
R6010:Upf1 UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R6056:Upf1 UTSW 8 70,785,687 (GRCm39) missense probably damaging 0.98
R6870:Upf1 UTSW 8 70,794,211 (GRCm39) missense probably benign 0.11
R7205:Upf1 UTSW 8 70,792,695 (GRCm39) missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70,793,268 (GRCm39) missense probably damaging 1.00
R7464:Upf1 UTSW 8 70,786,073 (GRCm39) missense probably benign
R7759:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R7783:Upf1 UTSW 8 70,805,508 (GRCm39) missense probably benign 0.11
R8192:Upf1 UTSW 8 70,793,294 (GRCm39) missense probably benign 0.03
R8544:Upf1 UTSW 8 70,789,702 (GRCm39) missense probably damaging 1.00
R8738:Upf1 UTSW 8 70,785,973 (GRCm39) missense probably benign 0.06
R8738:Upf1 UTSW 8 70,785,972 (GRCm39) missense probably benign 0.01
R8826:Upf1 UTSW 8 70,790,930 (GRCm39) missense probably benign
R8876:Upf1 UTSW 8 70,796,918 (GRCm39) missense possibly damaging 0.92
R8906:Upf1 UTSW 8 70,786,815 (GRCm39) nonsense probably null
R8911:Upf1 UTSW 8 70,791,087 (GRCm39) missense possibly damaging 0.53
R9163:Upf1 UTSW 8 70,792,674 (GRCm39) missense probably benign
R9425:Upf1 UTSW 8 70,792,003 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTGTAATAGGCAGGTACAGC -3'
(R):5'- CCACTCTCAGGTGCCATTAG -3'

Sequencing Primer
(F):5'- TCAGCTCAACGGTGACCTC -3'
(R):5'- CTAGGGCCAGGGTCTGTAG -3'
Posted On 2020-06-30