Incidental Mutation 'R8079:Fem1b'
ID 629214
Institutional Source Beutler Lab
Gene Symbol Fem1b
Ensembl Gene ENSMUSG00000032244
Gene Name fem 1 homolog b
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8079 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 62699106-62718930 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62703643 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 539 (I539N)
Ref Sequence ENSEMBL: ENSMUSP00000034775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034775]
AlphaFold Q9Z2G0
Predicted Effect probably damaging
Transcript: ENSMUST00000034775
AA Change: I539N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034775
Gene: ENSMUSG00000032244
AA Change: I539N

DomainStartEndE-ValueType
ANK 45 74 6.81e-3 SMART
ANK 87 116 6.65e-6 SMART
ANK 120 149 8.39e-3 SMART
ANK 153 182 8.91e-7 SMART
ANK 186 215 4.13e-2 SMART
ANK 218 246 6.71e-2 SMART
ANK 483 527 1.72e1 SMART
ANK 531 570 6.05e2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ankyrin repeat protein that belongs to the death receptor-associated family of proteins and plays a role in mediating apoptosis. The encoded protein is also thought to function in the replication stress-induced checkpoint signaling pathway via interaction with checkpoint kinase 1. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous targeted mutants display abnormal glucose tolerance due to defective glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,221,186 (GRCm39) I255T possibly damaging Het
Ablim1 A T 19: 57,170,656 (GRCm39) probably null Het
Akap10 G A 11: 61,820,880 (GRCm39) P8L possibly damaging Het
Ankle2 C T 5: 110,379,182 (GRCm39) A27V probably damaging Het
Anxa8 A G 14: 33,816,769 (GRCm39) T246A probably benign Het
Arhgap5 A G 12: 52,613,988 (GRCm39) N1460S probably benign Het
Arid5b T G 10: 67,934,186 (GRCm39) D572A possibly damaging Het
Atrn T A 2: 130,855,561 (GRCm39) L1278Q probably null Het
AU040320 G T 4: 126,725,953 (GRCm39) K454N possibly damaging Het
Baz2b T A 2: 59,731,112 (GRCm39) R2085W probably damaging Het
Bbx A T 16: 50,030,821 (GRCm39) N649K probably damaging Het
BC034090 G A 1: 155,101,032 (GRCm39) P411S probably damaging Het
Calcoco2 A T 11: 95,998,363 (GRCm39) F20Y probably damaging Het
Carmil2 A G 8: 106,413,393 (GRCm39) R50G probably damaging Het
Catspere2 A G 1: 177,874,525 (GRCm39) T131A probably benign Het
Cdcp1 C A 9: 123,002,855 (GRCm39) V739L probably damaging Het
Chit1 A G 1: 134,071,765 (GRCm39) T92A possibly damaging Het
Clstn3 A G 6: 124,436,763 (GRCm39) I185T probably damaging Het
Dctpp1 C A 7: 126,858,561 (GRCm39) V61L probably damaging Het
Dip2a T C 10: 76,123,155 (GRCm39) T760A probably benign Het
Dock10 C T 1: 80,556,421 (GRCm39) V552I probably benign Het
Dpp8 A G 9: 64,951,017 (GRCm39) E151G probably damaging Het
Dvl2 G C 11: 69,898,344 (GRCm39) R367P possibly damaging Het
Frat2 A T 19: 41,836,277 (GRCm39) L25H probably damaging Het
Garnl3 A T 2: 32,908,511 (GRCm39) probably null Het
Gh T C 11: 106,192,253 (GRCm39) H47R possibly damaging Het
Glmp T C 3: 88,233,045 (GRCm39) V61A probably damaging Het
Gm9925 T C 18: 74,198,558 (GRCm39) V129A unknown Het
H2-M9 T A 17: 36,953,025 (GRCm39) E94V probably benign Het
Hira A T 16: 18,744,507 (GRCm39) Q408L probably benign Het
Hook3 A G 8: 26,578,086 (GRCm39) probably null Het
Ifi206 G A 1: 173,308,724 (GRCm39) P424L Het
Impdh2 T C 9: 108,440,524 (GRCm39) V270A probably benign Het
Klhl14 A G 18: 21,785,022 (GRCm39) I135T probably benign Het
Klra10 C A 6: 130,252,738 (GRCm39) V179L probably benign Het
Kmt2c T C 5: 25,507,730 (GRCm39) S3236G probably damaging Het
Krt76 G T 15: 101,796,825 (GRCm39) A358D possibly damaging Het
Lacc1 C A 14: 77,266,992 (GRCm39) G424C probably damaging Het
Limch1 A G 5: 67,204,096 (GRCm39) I878V possibly damaging Het
Lipi C T 16: 75,362,418 (GRCm39) probably null Het
Lrrc17 C T 5: 21,766,069 (GRCm39) R184W probably damaging Het
Mllt10 A G 2: 18,128,567 (GRCm39) N183D probably damaging Het
Mterf2 C T 10: 84,956,027 (GRCm39) G199D probably damaging Het
Mucl3 T C 17: 35,949,084 (GRCm39) T172A unknown Het
Nat8f4 A T 6: 85,877,976 (GRCm39) S182R probably benign Het
Ndrg3 C A 2: 156,779,452 (GRCm39) E238* probably null Het
Nop14 A T 5: 34,811,805 (GRCm39) L194H probably damaging Het
Obscn T C 11: 58,972,731 (GRCm39) E2105G possibly damaging Het
Or5b104 A C 19: 13,072,648 (GRCm39) Y121* probably null Het
Or5g9 A T 2: 85,552,387 (GRCm39) T213S probably benign Het
Or7g17 A T 9: 18,768,725 (GRCm39) Y259F possibly damaging Het
Or8k32 T A 2: 86,368,725 (GRCm39) H176L possibly damaging Het
Pbx3 C T 2: 34,068,240 (GRCm39) A320T probably benign Het
Pcdhac2 A T 18: 37,279,197 (GRCm39) S726C probably damaging Het
Pcdhgb2 A G 18: 37,823,816 (GRCm39) D269G probably damaging Het
Pcgf6 A T 19: 47,034,271 (GRCm39) S257T probably damaging Het
Pclo A T 5: 14,590,472 (GRCm39) H924L unknown Het
Per3 T A 4: 151,127,135 (GRCm39) T129S possibly damaging Het
Pi4ka A T 16: 17,120,924 (GRCm39) M1270K Het
Plec G A 15: 76,063,750 (GRCm39) Q2277* probably null Het
Pnma1 T A 12: 84,194,109 (GRCm39) K198M probably damaging Het
Prc1 T A 7: 79,954,515 (GRCm39) F196L possibly damaging Het
Prkcz T C 4: 155,441,962 (GRCm39) T57A probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Robo4 A G 9: 37,313,931 (GRCm39) M61V possibly damaging Het
Rps12 C T 10: 23,661,575 (GRCm39) V79I probably benign Het
Rsph3a A G 17: 8,198,020 (GRCm39) K466E probably benign Het
Scly A T 1: 91,236,089 (GRCm39) I168F probably damaging Het
Setd1a T A 7: 127,384,225 (GRCm39) F359I unknown Het
Sh3tc1 A G 5: 35,864,201 (GRCm39) L662P possibly damaging Het
Slc12a5 T C 2: 164,834,372 (GRCm39) W798R probably damaging Het
Slc16a6 C T 11: 109,364,281 (GRCm39) R13Q unknown Het
Slco1a8 T G 6: 141,933,460 (GRCm39) M462L probably benign Het
Smarcad1 A G 6: 65,029,766 (GRCm39) D118G possibly damaging Het
Sos2 T C 12: 69,653,989 (GRCm39) T788A probably damaging Het
Syvn1 A G 19: 6,098,396 (GRCm39) E75G probably null Het
Thpo T C 16: 20,545,144 (GRCm39) E103G probably benign Het
Trav7d-3 A T 14: 52,982,193 (GRCm39) E78V possibly damaging Het
Uap1 A G 1: 169,986,332 (GRCm39) S217P probably damaging Het
Unc45a T G 7: 79,981,310 (GRCm39) R497S probably damaging Het
Upf1 A G 8: 70,791,534 (GRCm39) probably null Het
Usp47 A T 7: 111,646,177 (GRCm39) K28M probably damaging Het
Wdr72 A C 9: 74,126,054 (GRCm39) T1062P probably damaging Het
Wnt7b A T 15: 85,421,646 (GRCm39) C339S probably damaging Het
Zfp954 G T 7: 7,118,470 (GRCm39) T358K probably benign Het
Zmynd15 G T 11: 70,350,278 (GRCm39) probably benign Het
Other mutations in Fem1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Fem1b APN 9 62,704,201 (GRCm39) missense probably damaging 1.00
IGL01306:Fem1b APN 9 62,704,810 (GRCm39) missense possibly damaging 0.69
IGL02059:Fem1b APN 9 62,703,446 (GRCm39) missense possibly damaging 0.57
IGL02292:Fem1b APN 9 62,703,977 (GRCm39) missense probably benign 0.00
IGL03390:Fem1b APN 9 62,704,246 (GRCm39) missense probably benign 0.01
physeter UTSW 9 62,704,916 (GRCm39) missense probably damaging 0.99
ANU23:Fem1b UTSW 9 62,704,810 (GRCm39) missense possibly damaging 0.69
R0054:Fem1b UTSW 9 62,704,082 (GRCm39) missense probably damaging 1.00
R0054:Fem1b UTSW 9 62,704,082 (GRCm39) missense probably damaging 1.00
R0733:Fem1b UTSW 9 62,704,125 (GRCm39) missense possibly damaging 0.50
R1661:Fem1b UTSW 9 62,704,556 (GRCm39) missense probably damaging 0.96
R1697:Fem1b UTSW 9 62,704,456 (GRCm39) missense possibly damaging 0.56
R2228:Fem1b UTSW 9 62,704,020 (GRCm39) nonsense probably null
R2326:Fem1b UTSW 9 62,704,285 (GRCm39) missense probably damaging 0.98
R3123:Fem1b UTSW 9 62,703,836 (GRCm39) missense probably benign 0.00
R3124:Fem1b UTSW 9 62,703,836 (GRCm39) missense probably benign 0.00
R3125:Fem1b UTSW 9 62,703,836 (GRCm39) missense probably benign 0.00
R4849:Fem1b UTSW 9 62,704,576 (GRCm39) missense probably damaging 1.00
R5749:Fem1b UTSW 9 62,704,288 (GRCm39) missense probably damaging 1.00
R6338:Fem1b UTSW 9 62,704,293 (GRCm39) missense probably benign 0.08
R6727:Fem1b UTSW 9 62,704,015 (GRCm39) missense possibly damaging 0.65
R7036:Fem1b UTSW 9 62,704,310 (GRCm39) missense probably damaging 1.00
R7287:Fem1b UTSW 9 62,703,404 (GRCm39) missense probably benign 0.00
R7538:Fem1b UTSW 9 62,718,449 (GRCm39) missense probably damaging 0.98
R7877:Fem1b UTSW 9 62,703,844 (GRCm39) missense probably benign 0.13
R8110:Fem1b UTSW 9 62,703,550 (GRCm39) missense probably damaging 1.00
R8682:Fem1b UTSW 9 62,704,432 (GRCm39) nonsense probably null
R8924:Fem1b UTSW 9 62,704,916 (GRCm39) missense probably damaging 0.99
R9334:Fem1b UTSW 9 62,703,604 (GRCm39) nonsense probably null
R9592:Fem1b UTSW 9 62,704,959 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACTTGAGGCTCATCTTC -3'
(R):5'- TCAGTGCAGAATTAACAAGCAG -3'

Sequencing Primer
(F):5'- ACTTGAGGCTCATCTTCATCTGAG -3'
(R):5'- CCCAGAACACGGGAAGGTTTTTC -3'
Posted On 2020-06-30