Incidental Mutation 'R8079:Akap10'
ID 629224
Institutional Source Beutler Lab
Gene Symbol Akap10
Ensembl Gene ENSMUSG00000047804
Gene Name A kinase anchor protein 10
Synonyms B130049N18Rik, D-AKAP2, 1500031L16Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.718) question?
Stock # R8079 (G1)
Quality Score 126.008
Status Not validated
Chromosome 11
Chromosomal Location 61762133-61821078 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 61820880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 8 (P8L)
Ref Sequence ENSEMBL: ENSMUSP00000099710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102650] [ENSMUST00000108710]
AlphaFold O88845
Predicted Effect possibly damaging
Transcript: ENSMUST00000102650
AA Change: P8L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099710
Gene: ENSMUSG00000047804
AA Change: P8L

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
PDB:3TMH|L 623 662 2e-18 PDB
Blast:S_TKc 636 661 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108710
AA Change: P8L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104350
Gene: ENSMUSG00000047804
AA Change: P8L

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. It has been reported that this protein is important for maintaining heart rate and myocardial contractility through its targeting of protein kinase A. In mouse, defects of this gene lead to cardiac arrhythmias and premature death. In humans, polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele display sinus arrhythmia, sinus pauses, and atrioventricular heart block indicating excessive vagus nerve sensitivity; about 50% of homozygous and 25% of heterozygous mutant mice die in the first year of life, and survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,221,186 (GRCm39) I255T possibly damaging Het
Ablim1 A T 19: 57,170,656 (GRCm39) probably null Het
Ankle2 C T 5: 110,379,182 (GRCm39) A27V probably damaging Het
Anxa8 A G 14: 33,816,769 (GRCm39) T246A probably benign Het
Arhgap5 A G 12: 52,613,988 (GRCm39) N1460S probably benign Het
Arid5b T G 10: 67,934,186 (GRCm39) D572A possibly damaging Het
Atrn T A 2: 130,855,561 (GRCm39) L1278Q probably null Het
AU040320 G T 4: 126,725,953 (GRCm39) K454N possibly damaging Het
Baz2b T A 2: 59,731,112 (GRCm39) R2085W probably damaging Het
Bbx A T 16: 50,030,821 (GRCm39) N649K probably damaging Het
BC034090 G A 1: 155,101,032 (GRCm39) P411S probably damaging Het
Calcoco2 A T 11: 95,998,363 (GRCm39) F20Y probably damaging Het
Carmil2 A G 8: 106,413,393 (GRCm39) R50G probably damaging Het
Catspere2 A G 1: 177,874,525 (GRCm39) T131A probably benign Het
Cdcp1 C A 9: 123,002,855 (GRCm39) V739L probably damaging Het
Chit1 A G 1: 134,071,765 (GRCm39) T92A possibly damaging Het
Clstn3 A G 6: 124,436,763 (GRCm39) I185T probably damaging Het
Dctpp1 C A 7: 126,858,561 (GRCm39) V61L probably damaging Het
Dip2a T C 10: 76,123,155 (GRCm39) T760A probably benign Het
Dock10 C T 1: 80,556,421 (GRCm39) V552I probably benign Het
Dpp8 A G 9: 64,951,017 (GRCm39) E151G probably damaging Het
Dvl2 G C 11: 69,898,344 (GRCm39) R367P possibly damaging Het
Fem1b A T 9: 62,703,643 (GRCm39) I539N probably damaging Het
Frat2 A T 19: 41,836,277 (GRCm39) L25H probably damaging Het
Garnl3 A T 2: 32,908,511 (GRCm39) probably null Het
Gh T C 11: 106,192,253 (GRCm39) H47R possibly damaging Het
Glmp T C 3: 88,233,045 (GRCm39) V61A probably damaging Het
Gm9925 T C 18: 74,198,558 (GRCm39) V129A unknown Het
H2-M9 T A 17: 36,953,025 (GRCm39) E94V probably benign Het
Hira A T 16: 18,744,507 (GRCm39) Q408L probably benign Het
Hook3 A G 8: 26,578,086 (GRCm39) probably null Het
Ifi206 G A 1: 173,308,724 (GRCm39) P424L Het
Impdh2 T C 9: 108,440,524 (GRCm39) V270A probably benign Het
Klhl14 A G 18: 21,785,022 (GRCm39) I135T probably benign Het
Klra10 C A 6: 130,252,738 (GRCm39) V179L probably benign Het
Kmt2c T C 5: 25,507,730 (GRCm39) S3236G probably damaging Het
Krt76 G T 15: 101,796,825 (GRCm39) A358D possibly damaging Het
Lacc1 C A 14: 77,266,992 (GRCm39) G424C probably damaging Het
Limch1 A G 5: 67,204,096 (GRCm39) I878V possibly damaging Het
Lipi C T 16: 75,362,418 (GRCm39) probably null Het
Lrrc17 C T 5: 21,766,069 (GRCm39) R184W probably damaging Het
Mllt10 A G 2: 18,128,567 (GRCm39) N183D probably damaging Het
Mterf2 C T 10: 84,956,027 (GRCm39) G199D probably damaging Het
Mucl3 T C 17: 35,949,084 (GRCm39) T172A unknown Het
Nat8f4 A T 6: 85,877,976 (GRCm39) S182R probably benign Het
Ndrg3 C A 2: 156,779,452 (GRCm39) E238* probably null Het
Nop14 A T 5: 34,811,805 (GRCm39) L194H probably damaging Het
Obscn T C 11: 58,972,731 (GRCm39) E2105G possibly damaging Het
Or5b104 A C 19: 13,072,648 (GRCm39) Y121* probably null Het
Or5g9 A T 2: 85,552,387 (GRCm39) T213S probably benign Het
Or7g17 A T 9: 18,768,725 (GRCm39) Y259F possibly damaging Het
Or8k32 T A 2: 86,368,725 (GRCm39) H176L possibly damaging Het
Pbx3 C T 2: 34,068,240 (GRCm39) A320T probably benign Het
Pcdhac2 A T 18: 37,279,197 (GRCm39) S726C probably damaging Het
Pcdhgb2 A G 18: 37,823,816 (GRCm39) D269G probably damaging Het
Pcgf6 A T 19: 47,034,271 (GRCm39) S257T probably damaging Het
Pclo A T 5: 14,590,472 (GRCm39) H924L unknown Het
Per3 T A 4: 151,127,135 (GRCm39) T129S possibly damaging Het
Pi4ka A T 16: 17,120,924 (GRCm39) M1270K Het
Plec G A 15: 76,063,750 (GRCm39) Q2277* probably null Het
Pnma1 T A 12: 84,194,109 (GRCm39) K198M probably damaging Het
Prc1 T A 7: 79,954,515 (GRCm39) F196L possibly damaging Het
Prkcz T C 4: 155,441,962 (GRCm39) T57A probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Robo4 A G 9: 37,313,931 (GRCm39) M61V possibly damaging Het
Rps12 C T 10: 23,661,575 (GRCm39) V79I probably benign Het
Rsph3a A G 17: 8,198,020 (GRCm39) K466E probably benign Het
Scly A T 1: 91,236,089 (GRCm39) I168F probably damaging Het
Setd1a T A 7: 127,384,225 (GRCm39) F359I unknown Het
Sh3tc1 A G 5: 35,864,201 (GRCm39) L662P possibly damaging Het
Slc12a5 T C 2: 164,834,372 (GRCm39) W798R probably damaging Het
Slc16a6 C T 11: 109,364,281 (GRCm39) R13Q unknown Het
Slco1a8 T G 6: 141,933,460 (GRCm39) M462L probably benign Het
Smarcad1 A G 6: 65,029,766 (GRCm39) D118G possibly damaging Het
Sos2 T C 12: 69,653,989 (GRCm39) T788A probably damaging Het
Syvn1 A G 19: 6,098,396 (GRCm39) E75G probably null Het
Thpo T C 16: 20,545,144 (GRCm39) E103G probably benign Het
Trav7d-3 A T 14: 52,982,193 (GRCm39) E78V possibly damaging Het
Uap1 A G 1: 169,986,332 (GRCm39) S217P probably damaging Het
Unc45a T G 7: 79,981,310 (GRCm39) R497S probably damaging Het
Upf1 A G 8: 70,791,534 (GRCm39) probably null Het
Usp47 A T 7: 111,646,177 (GRCm39) K28M probably damaging Het
Wdr72 A C 9: 74,126,054 (GRCm39) T1062P probably damaging Het
Wnt7b A T 15: 85,421,646 (GRCm39) C339S probably damaging Het
Zfp954 G T 7: 7,118,470 (GRCm39) T358K probably benign Het
Zmynd15 G T 11: 70,350,278 (GRCm39) probably benign Het
Other mutations in Akap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Akap10 APN 11 61,805,897 (GRCm39) missense possibly damaging 0.85
IGL00971:Akap10 APN 11 61,795,622 (GRCm39) missense possibly damaging 0.68
IGL01510:Akap10 APN 11 61,768,846 (GRCm39) missense possibly damaging 0.74
IGL02731:Akap10 APN 11 61,784,302 (GRCm39) missense possibly damaging 0.78
IGL03289:Akap10 APN 11 61,768,794 (GRCm39) splice site probably benign
IGL03294:Akap10 APN 11 61,768,179 (GRCm39) missense probably damaging 1.00
IGL03403:Akap10 APN 11 61,806,099 (GRCm39) missense probably benign 0.00
P4748:Akap10 UTSW 11 61,763,846 (GRCm39) missense possibly damaging 0.86
R0924:Akap10 UTSW 11 61,795,689 (GRCm39) splice site probably benign
R1324:Akap10 UTSW 11 61,805,847 (GRCm39) splice site probably null
R2117:Akap10 UTSW 11 61,781,129 (GRCm39) missense possibly damaging 0.73
R2243:Akap10 UTSW 11 61,806,327 (GRCm39) missense possibly damaging 0.56
R2402:Akap10 UTSW 11 61,806,048 (GRCm39) missense probably benign
R2567:Akap10 UTSW 11 61,784,175 (GRCm39) intron probably benign
R3745:Akap10 UTSW 11 61,806,131 (GRCm39) missense probably benign
R5124:Akap10 UTSW 11 61,807,015 (GRCm39) missense probably damaging 1.00
R5126:Akap10 UTSW 11 61,807,015 (GRCm39) missense probably damaging 1.00
R5180:Akap10 UTSW 11 61,807,015 (GRCm39) missense probably damaging 1.00
R5219:Akap10 UTSW 11 61,813,617 (GRCm39) missense probably benign
R5324:Akap10 UTSW 11 61,807,015 (GRCm39) missense probably damaging 1.00
R6753:Akap10 UTSW 11 61,777,603 (GRCm39) missense probably damaging 0.96
R7121:Akap10 UTSW 11 61,777,524 (GRCm39) critical splice donor site probably null
R7763:Akap10 UTSW 11 61,806,331 (GRCm39) missense probably damaging 1.00
R7867:Akap10 UTSW 11 61,791,272 (GRCm39) missense probably damaging 1.00
R7986:Akap10 UTSW 11 61,820,890 (GRCm39) missense probably damaging 1.00
R9321:Akap10 UTSW 11 61,791,235 (GRCm39) missense probably damaging 1.00
R9732:Akap10 UTSW 11 61,787,545 (GRCm39) missense probably damaging 1.00
Z1186:Akap10 UTSW 11 61,806,096 (GRCm39) missense probably benign 0.00
Z1187:Akap10 UTSW 11 61,806,096 (GRCm39) missense probably benign 0.00
Z1188:Akap10 UTSW 11 61,806,096 (GRCm39) missense probably benign 0.00
Z1189:Akap10 UTSW 11 61,806,096 (GRCm39) missense probably benign 0.00
Z1190:Akap10 UTSW 11 61,806,096 (GRCm39) missense probably benign 0.00
Z1191:Akap10 UTSW 11 61,806,096 (GRCm39) missense probably benign 0.00
Z1192:Akap10 UTSW 11 61,806,096 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTTTTGGCCCAAAGCGAC -3'
(R):5'- AAGAGACGCTGTCATCCGAAG -3'

Sequencing Primer
(F):5'- TTTGGCCCAAAGCGACAATGC -3'
(R):5'- TGTCATCCGAAGCCTCCAG -3'
Posted On 2020-06-30