Mutagenetix > Incidental Mutation

Incidental Mutation 'R8079:Pi4ka'

629239

Institutional Source

Beutler Lab

Gene Symbol

Pi4ka

Ensembl Gene

ENSMUSG00000041720

Gene Name

phosphatidylinositol 4-kinase alpha

Synonyms

Pik4ca

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8079 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

17280351-17406314 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 17303060 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1270 (M1270K)

Ref Sequence

ENSEMBL: ENSMUSP00000036162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000232232]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: M1270K

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

Predicted Effect

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 96.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	A	G	5: 124,083,123	I255T	possibly damaging	Het
Ablim1	A	T	19: 57,182,224		probably null	Het
Akap10	G	A	11: 61,930,054	P8L	possibly damaging	Het
Ankle2	C	T	5: 110,231,316	A27V	probably damaging	Het
Anxa8	A	G	14: 34,094,812	T246A	probably benign	Het
Arhgap5	A	G	12: 52,567,205	N1460S	probably benign	Het
Arid5b	T	G	10: 68,098,356	D572A	possibly damaging	Het
Atrn	T	A	2: 131,013,641	L1278Q	probably null	Het
AU040320	G	T	4: 126,832,160	K454N	possibly damaging	Het
Baz2b	T	A	2: 59,900,768	R2085W	probably damaging	Het
Bbx	A	T	16: 50,210,458	N649K	probably damaging	Het
BC034090	G	A	1: 155,225,286	P411S	probably damaging	Het
Calcoco2	A	T	11: 96,107,537	F20Y	probably damaging	Het
Carmil2	A	G	8: 105,686,761	R50G	probably damaging	Het
Catspere2	A	G	1: 178,046,959	T131A	probably benign	Het
Cdcp1	C	A	9: 123,173,790	V739L	probably damaging	Het
Chit1	A	G	1: 134,144,027	T92A	possibly damaging	Het
Clstn3	A	G	6: 124,459,804	I185T	probably damaging	Het
Dctpp1	C	A	7: 127,259,389	V61L	probably damaging	Het
Dip2a	T	C	10: 76,287,321	T760A	probably benign	Het
Dock10	C	T	1: 80,578,704	V552I	probably benign	Het
Dpcr1	T	C	17: 35,638,192	T172A	unknown	Het
Dpp8	A	G	9: 65,043,735	E151G	probably damaging	Het
Dvl2	G	C	11: 70,007,518	R367P	possibly damaging	Het
Fem1b	A	T	9: 62,796,361	I539N	probably damaging	Het
Frat2	A	T	19: 41,847,838	L25H	probably damaging	Het
Garnl3	A	T	2: 33,018,499		probably null	Het
Gh	T	C	11: 106,301,427	H47R	possibly damaging	Het
Glmp	T	C	3: 88,325,738	V61A	probably damaging	Het
Gm6614	T	G	6: 141,987,734	M462L	probably benign	Het
Gm9925	T	C	18: 74,065,487	V129A	unknown	Het
H2-M9	T	A	17: 36,642,133	E94V	probably benign	Het
Hira	A	T	16: 18,925,757	Q408L	probably benign	Het
Hook3	A	G	8: 26,088,058		probably null	Het
Ifi206	G	A	1: 173,481,158	P424L		Het
Impdh2	T	C	9: 108,563,325	V270A	probably benign	Het
Klhl14	A	G	18: 21,651,965	I135T	probably benign	Het
Klra10	C	A	6: 130,275,775	V179L	probably benign	Het
Kmt2c	T	C	5: 25,302,732	S3236G	probably damaging	Het
Krt76	G	T	15: 101,888,390	A358D	possibly damaging	Het
Lacc1	C	A	14: 77,029,552	G424C	probably damaging	Het
Limch1	A	G	5: 67,046,753	I878V	possibly damaging	Het
Lipi	C	T	16: 75,565,530		probably null	Het
Lrrc17	C	T	5: 21,561,071	R184W	probably damaging	Het
Mllt10	A	G	2: 18,123,756	N183D	probably damaging	Het
Mterf2	C	T	10: 85,120,163	G199D	probably damaging	Het
Nat8f4	A	T	6: 85,900,994	S182R	probably benign	Het
Ndrg3	C	A	2: 156,937,532	E238*	probably null	Het
Nop14	A	T	5: 34,654,461	L194H	probably damaging	Het
Obscn	T	C	11: 59,081,905	E2105G	possibly damaging	Het
Olfr1009	A	T	2: 85,722,043	T213S	probably benign	Het
Olfr1079	T	A	2: 86,538,381	H176L	possibly damaging	Het
Olfr1457	A	C	19: 13,095,284	Y121*	probably null	Het
Olfr829	A	T	9: 18,857,429	Y259F	possibly damaging	Het
Pbx3	C	T	2: 34,178,228	A320T	probably benign	Het
Pcdhac2	A	T	18: 37,146,144	S726C	probably damaging	Het
Pcdhgb2	A	G	18: 37,690,763	D269G	probably damaging	Het
Pcgf6	A	T	19: 47,045,832	S257T	probably damaging	Het
Pclo	A	T	5: 14,540,458	H924L	unknown	Het
Per3	T	A	4: 151,042,678	T129S	possibly damaging	Het
Plec	G	A	15: 76,179,550	Q2277*	probably null	Het
Pnma1	T	A	12: 84,147,335	K198M	probably damaging	Het
Prc1	T	A	7: 80,304,767	F196L	possibly damaging	Het
Prkcz	T	C	4: 155,357,505	T57A	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Robo4	A	G	9: 37,402,635	M61V	possibly damaging	Het
Rps12	C	T	10: 23,785,677	V79I	probably benign	Het
Rsph3a	A	G	17: 7,979,188	K466E	probably benign	Het
Scly	A	T	1: 91,308,367	I168F	probably damaging	Het
Setd1a	T	A	7: 127,785,053	F359I	unknown	Het
Sh3tc1	A	G	5: 35,706,857	L662P	possibly damaging	Het
Slc12a5	T	C	2: 164,992,452	W798R	probably damaging	Het
Slc16a6	C	T	11: 109,473,455	R13Q	unknown	Het
Smarcad1	A	G	6: 65,052,782	D118G	possibly damaging	Het
Sos2	T	C	12: 69,607,215	T788A	probably damaging	Het
Syvn1	A	G	19: 6,048,366	E75G	probably null	Het
Thpo	T	C	16: 20,726,394	E103G	probably benign	Het
Trav7d-3	A	T	14: 52,744,736	E78V	possibly damaging	Het
Uap1	A	G	1: 170,158,763	S217P	probably damaging	Het
Unc45a	T	G	7: 80,331,562	R497S	probably damaging	Het
Upf1	A	G	8: 70,338,884		probably null	Het
Usp47	A	T	7: 112,046,970	K28M	probably damaging	Het
Wdr72	A	C	9: 74,218,772	T1062P	probably damaging	Het
Wnt7b	A	T	15: 85,537,445	C339S	probably damaging	Het
Zfp954	G	T	7: 7,115,471	T358K	probably benign	Het
Zmynd15	G	T	11: 70,459,452		probably benign	Het

Other mutations in Pi4ka

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Pi4ka	APN	16	17308144	missense	probably benign
IGL00984:Pi4ka	APN	16	17358932	nonsense	probably null
IGL01066:Pi4ka	APN	16	17348773	splice site	probably benign
IGL01460:Pi4ka	APN	16	17357651	missense	probably damaging	1.00
IGL01505:Pi4ka	APN	16	17309358	missense	probably benign	0.22
IGL01518:Pi4ka	APN	16	17280735	missense	probably benign	0.03
IGL01533:Pi4ka	APN	16	17308201	missense	probably benign	0.30
IGL01565:Pi4ka	APN	16	17389442	utr 5 prime	probably benign
IGL01679:Pi4ka	APN	16	17296888	splice site	probably benign
IGL01685:Pi4ka	APN	16	17325202	missense	probably benign	0.09
IGL01734:Pi4ka	APN	16	17297260	missense	probably benign	0.23
IGL01799:Pi4ka	APN	16	17389371	missense	probably damaging	1.00
IGL01969:Pi4ka	APN	16	17378483	missense	probably benign	0.15
IGL02092:Pi4ka	APN	16	17318496	missense	probably benign	0.00
IGL02113:Pi4ka	APN	16	17373415	missense	probably benign	0.00
IGL02177:Pi4ka	APN	16	17318282	missense	probably benign	0.09
IGL02400:Pi4ka	APN	16	17293884	missense	probably damaging	0.98
IGL02426:Pi4ka	APN	16	17378432	splice site	probably benign
IGL02474:Pi4ka	APN	16	17325429	missense	probably damaging	1.00
IGL02587:Pi4ka	APN	16	17317353	missense	probably damaging	1.00
IGL02667:Pi4ka	APN	16	17295461	missense	possibly damaging	0.82
IGL02698:Pi4ka	APN	16	17291168	missense	probably damaging	1.00
IGL02815:Pi4ka	APN	16	17358889	splice site	probably benign
IGL02828:Pi4ka	APN	16	17280711	intron	probably benign
IGL02939:Pi4ka	APN	16	17354210	missense	probably damaging	0.97
IGL03123:Pi4ka	APN	16	17282675	missense	possibly damaging	0.95
IGL03148:Pi4ka	APN	16	17354189	missense	probably damaging	0.99
arachnoid	UTSW	16	17285281	unclassified	probably benign
dove_bar	UTSW	16	17326052	splice site	probably null
mia	UTSW	16	17376982	missense	possibly damaging	0.89
Pia	UTSW	16	17281044	missense	probably damaging	1.00
G1patch:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
IGL03098:Pi4ka	UTSW	16	17326027	missense	probably damaging	1.00
R0024:Pi4ka	UTSW	16	17315535	splice site	probably benign
R0054:Pi4ka	UTSW	16	17325114	missense	probably null	1.00
R0054:Pi4ka	UTSW	16	17325114	missense	probably null	1.00
R0243:Pi4ka	UTSW	16	17297635	missense	probably benign	0.44
R0374:Pi4ka	UTSW	16	17282932	unclassified	probably benign
R0478:Pi4ka	UTSW	16	17309311	missense	possibly damaging	0.92
R0548:Pi4ka	UTSW	16	17307718	missense	possibly damaging	0.75
R0626:Pi4ka	UTSW	16	17293901	missense	probably benign	0.00
R0918:Pi4ka	UTSW	16	17285260	missense	possibly damaging	0.61
R1082:Pi4ka	UTSW	16	17389352	missense	probably damaging	1.00
R1384:Pi4ka	UTSW	16	17297537	splice site	probably benign
R1455:Pi4ka	UTSW	16	17363954	missense	probably benign	0.02
R1479:Pi4ka	UTSW	16	17373400	missense	probably benign	0.08
R1490:Pi4ka	UTSW	16	17386268	missense	probably damaging	1.00
R1565:Pi4ka	UTSW	16	17281900	missense	probably null
R1594:Pi4ka	UTSW	16	17373419	splice site	probably benign
R1641:Pi4ka	UTSW	16	17377030	missense	probably benign	0.00
R1694:Pi4ka	UTSW	16	17295376	missense	probably damaging	0.99
R1828:Pi4ka	UTSW	16	17280750	missense	probably benign	0.00
R1864:Pi4ka	UTSW	16	17367525	nonsense	probably null
R2036:Pi4ka	UTSW	16	17303112	missense	probably damaging	1.00
R2151:Pi4ka	UTSW	16	17367507	missense	probably benign	0.44
R2844:Pi4ka	UTSW	16	17350793	missense	probably damaging	0.97
R2876:Pi4ka	UTSW	16	17367550	missense	possibly damaging	0.77
R3953:Pi4ka	UTSW	16	17285281	unclassified	probably benign
R3972:Pi4ka	UTSW	16	17293875	missense	probably damaging	1.00
R4357:Pi4ka	UTSW	16	17367439	missense	probably benign	0.00
R4385:Pi4ka	UTSW	16	17386265	missense	probably benign	0.13
R4427:Pi4ka	UTSW	16	17281044	missense	probably damaging	1.00
R4436:Pi4ka	UTSW	16	17282382	missense	probably damaging	1.00
R4677:Pi4ka	UTSW	16	17282373	missense	probably damaging	1.00
R4683:Pi4ka	UTSW	16	17297037	missense	possibly damaging	0.73
R4736:Pi4ka	UTSW	16	17377175	missense	probably benign	0.12
R4804:Pi4ka	UTSW	16	17308161	missense	possibly damaging	0.75
R4886:Pi4ka	UTSW	16	17358361	missense
R4893:Pi4ka	UTSW	16	17377036	missense	probably benign	0.21
R4896:Pi4ka	UTSW	16	17377169	missense	probably damaging	1.00
R5004:Pi4ka	UTSW	16	17377169	missense	probably damaging	1.00
R5015:Pi4ka	UTSW	16	17303082	missense	possibly damaging	0.56
R5062:Pi4ka	UTSW	16	17309397	missense	probably benign	0.02
R5104:Pi4ka	UTSW	16	17281050	missense	probably damaging	1.00
R5160:Pi4ka	UTSW	16	17323053	missense	probably benign	0.01
R5173:Pi4ka	UTSW	16	17350906	missense	possibly damaging	0.95
R5204:Pi4ka	UTSW	16	17359045	missense	possibly damaging	0.68
R5307:Pi4ka	UTSW	16	17323030	missense	probably benign	0.00
R5327:Pi4ka	UTSW	16	17325413	missense	probably damaging	1.00
R5506:Pi4ka	UTSW	16	17293953	missense	probably damaging	0.96
R5580:Pi4ka	UTSW	16	17281087	missense	probably damaging	1.00
R5768:Pi4ka	UTSW	16	17354872	missense	probably benign	0.29
R5857:Pi4ka	UTSW	16	17358984	missense	probably benign	0.00
R5951:Pi4ka	UTSW	16	17303142	missense	probably damaging	1.00
R5953:Pi4ka	UTSW	16	17281951	missense
R6041:Pi4ka	UTSW	16	17360572	missense	probably benign
R6223:Pi4ka	UTSW	16	17357571	nonsense	probably null
R6416:Pi4ka	UTSW	16	17358322	missense	probably benign	0.22
R6535:Pi4ka	UTSW	16	17301036	missense	probably damaging	1.00
R6580:Pi4ka	UTSW	16	17350830	missense	probably damaging	1.00
R6720:Pi4ka	UTSW	16	17326052	splice site	probably null
R6723:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6725:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6752:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6753:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6755:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6767:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6768:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6782:Pi4ka	UTSW	16	17325988	missense	probably damaging	1.00
R6782:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6788:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6849:Pi4ka	UTSW	16	17303421	missense	possibly damaging	0.54
R6958:Pi4ka	UTSW	16	17325227	missense	probably damaging	1.00
R7014:Pi4ka	UTSW	16	17297067	unclassified	probably benign
R7055:Pi4ka	UTSW	16	17317015	utr 3 prime	probably benign
R7317:Pi4ka	UTSW	16	17405632	critical splice donor site	probably null
R7533:Pi4ka	UTSW	16	17297661	missense
R7552:Pi4ka	UTSW	16	17291216	missense
R7581:Pi4ka	UTSW	16	17301060	missense
R7622:Pi4ka	UTSW	16	17293977	missense
R7717:Pi4ka	UTSW	16	17376923	missense
R8048:Pi4ka	UTSW	16	17303127	missense
R8052:Pi4ka	UTSW	16	17356166	missense
R8123:Pi4ka	UTSW	16	17281092	missense
R8211:Pi4ka	UTSW	16	17282905	missense
R8310:Pi4ka	UTSW	16	17354048	critical splice donor site	probably null
R8322:Pi4ka	UTSW	16	17357573	missense
R8509:Pi4ka	UTSW	16	17354144	missense
R8735:Pi4ka	UTSW	16	17318370	missense
R8912:Pi4ka	UTSW	16	17389366	missense
R8917:Pi4ka	UTSW	16	17312446	missense
R8921:Pi4ka	UTSW	16	17307740	missense
R8941:Pi4ka	UTSW	16	17296943	unclassified	probably benign
R9002:Pi4ka	UTSW	16	17299453	missense
R9203:Pi4ka	UTSW	16	17282301	missense
R9222:Pi4ka	UTSW	16	17358361	missense
R9230:Pi4ka	UTSW	16	17281924	missense
R9262:Pi4ka	UTSW	16	17302995	missense
R9338:Pi4ka	UTSW	16	17317363	missense
R9374:Pi4ka	UTSW	16	17307710	missense
R9436:Pi4ka	UTSW	16	17307806	missense
R9499:Pi4ka	UTSW	16	17307710	missense
R9501:Pi4ka	UTSW	16	17386292	missense
R9551:Pi4ka	UTSW	16	17307710	missense
R9705:Pi4ka	UTSW	16	17281951	missense
RF007:Pi4ka	UTSW	16	17297233	missense
U24488:Pi4ka	UTSW	16	17325176	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ATAGGATTTACTCTACACTGCAGAGC -3'
(R):5'- AGCTTTGTAGGGACAGCCTTG -3'

Sequencing Primer
(F):5'- TGCAGAGCAGCATCGCAG -3'
(R):5'- ACAGCCTTGGGGACACTTG -3'

Posted On

2020-06-30