Incidental Mutation 'R8080:Olfr1254'
ID629261
Institutional Source Beutler Lab
Gene Symbol Olfr1254
Ensembl Gene ENSMUSG00000075074
Gene Nameolfactory receptor 1254
SynonymsGA_x6K02T2Q125-51230155-51229211, MOR231-13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R8080 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89787325-89793619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89788627 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 242 (I242F)
Ref Sequence ENSEMBL: ENSMUSP00000107148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099764] [ENSMUST00000111523] [ENSMUST00000216587]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099764
AA Change: I242F

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097352
Gene: ENSMUSG00000075074
AA Change: I242F

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 9.7e-30 PFAM
Pfam:7tm_4 137 278 1.3e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111523
AA Change: I242F

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107148
Gene: ENSMUSG00000075074
AA Change: I242F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.4e-46 PFAM
Pfam:7tm_1 39 285 5.6e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216587
AA Change: I242F

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Olfr1254
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Olfr1254 APN 2 89788785 missense probably damaging 1.00
IGL02822:Olfr1254 APN 2 89789100 missense possibly damaging 0.56
R1166:Olfr1254 UTSW 2 89789331 missense possibly damaging 0.74
R1639:Olfr1254 UTSW 2 89789245 missense probably damaging 1.00
R2248:Olfr1254 UTSW 2 89789180 missense possibly damaging 0.59
R2256:Olfr1254 UTSW 2 89788470 missense probably benign
R2351:Olfr1254 UTSW 2 89789178 missense probably damaging 0.97
R4432:Olfr1254 UTSW 2 89788734 missense possibly damaging 0.76
R4649:Olfr1254 UTSW 2 89789293 missense probably benign 0.19
R4788:Olfr1254 UTSW 2 89789136 missense probably damaging 1.00
R6454:Olfr1254 UTSW 2 89789178 missense probably damaging 0.97
R6591:Olfr1254 UTSW 2 89788988 nonsense probably null
R6691:Olfr1254 UTSW 2 89788988 nonsense probably null
R7418:Olfr1254 UTSW 2 89788976 nonsense probably null
R7451:Olfr1254 UTSW 2 89789109 missense probably benign
R8024:Olfr1254 UTSW 2 89789046 missense probably benign 0.07
R8251:Olfr1254 UTSW 2 89789223 missense probably damaging 1.00
R8318:Olfr1254 UTSW 2 89788977 missense possibly damaging 0.60
X0022:Olfr1254 UTSW 2 89788731 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTGTTGCCCTAGAAAGACTATCC -3'
(R):5'- TGCTTGTGTGCTCTGACACC -3'

Sequencing Primer
(F):5'- GCCCTAGAAAGACTATCCTCTTTAAC -3'
(R):5'- GTGTGCTCTGACACCTACTTC -3'
Posted On2020-06-30