Incidental Mutation 'R8080:Bcl2l11'
ID629263
Institutional Source Beutler Lab
Gene Symbol Bcl2l11
Ensembl Gene ENSMUSG00000027381
Gene NameBCL2-like 11 (apoptosis facilitator)
SynonymsBod, 1500006F24Rik, Bim
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #R8080 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location128126038-128162547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128128666 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 12 (C12R)
Ref Sequence ENSEMBL: ENSMUSP00000105970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019281] [ENSMUST00000028859] [ENSMUST00000089634] [ENSMUST00000103210] [ENSMUST00000103211] [ENSMUST00000110341]
Predicted Effect probably damaging
Transcript: ENSMUST00000019281
AA Change: C12R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019281
Gene: ENSMUSG00000027381
AA Change: C12R

DomainStartEndE-ValueType
Pfam:Bim_N 4 40 1.2e-24 PFAM
Pfam:Bclx_interact 41 79 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028859
SMART Domains Protein: ENSMUSP00000028859
Gene: ENSMUSG00000027380

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 115 223 7.2e-19 PFAM
Pfam:Acyl-CoA_dh_1 254 416 1.8e-14 PFAM
Pfam:ACOX 458 599 6.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089634
AA Change: C12R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087062
Gene: ENSMUSG00000027381
AA Change: C12R

DomainStartEndE-ValueType
Pfam:Bim_N 4 40 1.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103210
AA Change: C12R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099499
Gene: ENSMUSG00000027381
AA Change: C12R

DomainStartEndE-ValueType
Pfam:Bim_N 4 40 6.7e-24 PFAM
Pfam:Bclx_interact 71 109 9.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103211
AA Change: C12R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099500
Gene: ENSMUSG00000027381
AA Change: C12R

DomainStartEndE-ValueType
Pfam:Bim_N 4 40 1.2e-24 PFAM
Pfam:Bclx_interact 41 79 1.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110341
AA Change: C12R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105970
Gene: ENSMUSG00000027381
AA Change: C12R

DomainStartEndE-ValueType
Pfam:Bim_N 4 40 1.3e-24 PFAM
low complexity region 80 90 N/A INTRINSIC
Pfam:Bclx_interact 128 165 3.6e-23 PFAM
Meta Mutation Damage Score 0.7797 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Jun 2013]
PHENOTYPE: Consistent with this gene's role in hematopoietic homeostasis, homozygous null mutants accumulate lymphoid and myeloid cells and succumb to autoimmune kidney disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Bcl2l11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Bcl2l11 APN 2 128128648 missense probably damaging 1.00
PIT4243001:Bcl2l11 UTSW 2 128147106 missense probably benign 0.03
R1656:Bcl2l11 UTSW 2 128158256 missense probably benign 0.07
R4548:Bcl2l11 UTSW 2 128129646 missense probably benign 0.03
R4871:Bcl2l11 UTSW 2 128129041 intron probably benign
R5941:Bcl2l11 UTSW 2 128127783 unclassified probably benign
R7112:Bcl2l11 UTSW 2 128158315 missense probably damaging 1.00
R7878:Bcl2l11 UTSW 2 128128688 nonsense probably null
Z1177:Bcl2l11 UTSW 2 128128995 missense probably damaging 1.00
Z1177:Bcl2l11 UTSW 2 128147193 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCTTCATTATTTTGGGCG -3'
(R):5'- TCTGGTAGCAAAAGGGCCAG -3'

Sequencing Primer
(F):5'- CCCTTTGGTCTTACTTGGCAGATAG -3'
(R):5'- TAGCAAAAGGGCCAGGGCTG -3'
Posted On2020-06-30