Incidental Mutation 'R8080:Lmna'
ID629266
Institutional Source Beutler Lab
Gene Symbol Lmna
Ensembl Gene ENSMUSG00000028063
Gene Namelamin A
SynonymsDhe, lamin A/C
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8080 (G1)
Quality Score170.009
Status Validated
Chromosome3
Chromosomal Location88480147-88509956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88486561 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 237 (F237L)
Ref Sequence ENSEMBL: ENSMUSP00000029699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029699] [ENSMUST00000036252] [ENSMUST00000120377]
PDB Structure
Solution structure of immunoglobulin like domain of mouse nuclear lamin [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000029699
AA Change: F237L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029699
Gene: ENSMUSG00000028063
AA Change: F237L

DomainStartEndE-ValueType
Filament 30 386 4.38e-45 SMART
low complexity region 395 414 N/A INTRINSIC
low complexity region 422 431 N/A INTRINSIC
Pfam:LTD 433 544 4e-15 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 600 639 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036252
AA Change: F125L

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040265
Gene: ENSMUSG00000028063
AA Change: F125L

DomainStartEndE-ValueType
Pfam:Filament 2 274 5.6e-66 PFAM
low complexity region 283 302 N/A INTRINSIC
Pfam:LTD 317 436 1.2e-22 PFAM
low complexity region 439 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120377
AA Change: F237L

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113093
Gene: ENSMUSG00000028063
AA Change: F237L

DomainStartEndE-ValueType
Pfam:Filament 30 386 1.3e-95 PFAM
low complexity region 395 414 N/A INTRINSIC
Pfam:LTD 429 548 1.7e-22 PFAM
low complexity region 551 562 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the lamin family. Nuclear lamins, intermediate filament-like proteins, are the major components of the nuclear lamina, a protein meshwork associated with the inner nuclear membrane. This meshwork is thought to maintain the integrity of the nuclear envelope, participate in chromatin organization, and regulate gene transcription. Vertebrate lamins consist of two types, A and B. This protein is an A-type and is proposed to be developmentally regulated. In mouse deficiency of this gene is associated with muscular dystrophy. Mouse lines with different mutations in this gene serve as pathophysiological models for several human laminopathies. In humans, mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit retarded postnatal growth, muscular dystrophy, reduced fat stores, micrognathy, abnormal dentition, impaired gonadal development, malformed scapulae, hyperkeratosis, and die by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Lmna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lmna APN 3 88484684 missense probably benign 0.05
IGL00933:Lmna APN 3 88482549 missense possibly damaging 0.73
IGL01347:Lmna APN 3 88484963 missense probably benign 0.42
IGL02881:Lmna APN 3 88502926 missense possibly damaging 0.56
P0029:Lmna UTSW 3 88483917 missense possibly damaging 0.88
R0606:Lmna UTSW 3 88482578 missense probably damaging 1.00
R1547:Lmna UTSW 3 88482351 missense probably benign 0.00
R4751:Lmna UTSW 3 88486533 missense possibly damaging 0.87
R5157:Lmna UTSW 3 88484107 missense probably damaging 1.00
R5857:Lmna UTSW 3 88482531 unclassified probably benign
R6112:Lmna UTSW 3 88486621 nonsense probably null
R6263:Lmna UTSW 3 88502958 missense probably damaging 1.00
R6328:Lmna UTSW 3 88486506 missense probably damaging 1.00
R6604:Lmna UTSW 3 88488282 missense probably damaging 0.97
R7100:Lmna UTSW 3 88484990 missense probably damaging 0.99
RF013:Lmna UTSW 3 88484054 missense probably benign 0.00
Z1177:Lmna UTSW 3 88486236 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCAGGGAGCACACAGTTATG -3'
(R):5'- TAATGCCAGGCTAAGCGAGG -3'

Sequencing Primer
(F):5'- CACAGTTATGAGAGCAGGAACCTG -3'
(R):5'- GGAACCATTGCGATGTTCT -3'
Posted On2020-06-30