Incidental Mutation 'R8080:Negr1'
ID629268
Institutional Source Beutler Lab
Gene Symbol Negr1
Ensembl Gene ENSMUSG00000040037
Gene Nameneuronal growth regulator 1
SynonymsNtra, 5330422G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8080 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location156561794-157316445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 157160720 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 302 (A302E)
Ref Sequence ENSEMBL: ENSMUSP00000073664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041425] [ENSMUST00000074015] [ENSMUST00000106065]
Predicted Effect probably damaging
Transcript: ENSMUST00000041425
AA Change: A302E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041132
Gene: ENSMUSG00000040037
AA Change: A302E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 39 130 2.52e-9 SMART
IGc2 145 204 3.22e-16 SMART
IGc2 230 298 3.82e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074015
AA Change: A302E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073664
Gene: ENSMUSG00000040037
AA Change: A302E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 39 130 2.52e-9 SMART
IGc2 145 204 3.22e-16 SMART
IGc2 230 298 3.82e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106065
AA Change: A302E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101680
Gene: ENSMUSG00000040037
AA Change: A302E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 39 130 2.52e-9 SMART
IGc2 145 204 3.22e-16 SMART
IGc2 230 298 3.82e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out or ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Negr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Negr1 APN 3 157146217 missense probably damaging 1.00
IGL01635:Negr1 APN 3 156562292 missense probably benign 0.00
IGL02006:Negr1 APN 3 157016173 splice site probably benign
IGL02427:Negr1 APN 3 156562190 start gained probably benign
IGL02542:Negr1 APN 3 156562225 missense probably damaging 1.00
PIT4466001:Negr1 UTSW 3 156859598 missense probably benign 0.44
R0241:Negr1 UTSW 3 157208399 intron probably benign
R0496:Negr1 UTSW 3 157016267 missense probably damaging 1.00
R0506:Negr1 UTSW 3 157160748 splice site probably benign
R0507:Negr1 UTSW 3 156562225 missense probably damaging 0.97
R0634:Negr1 UTSW 3 157016266 missense possibly damaging 0.51
R1324:Negr1 UTSW 3 157069223 missense probably damaging 1.00
R1923:Negr1 UTSW 3 156562199 missense probably benign 0.06
R4569:Negr1 UTSW 3 157208376 intron probably benign
R4592:Negr1 UTSW 3 157208386 intron probably benign
R4874:Negr1 UTSW 3 156859445 missense probably damaging 0.98
R5137:Negr1 UTSW 3 157016196 missense probably damaging 0.99
R5330:Negr1 UTSW 3 157069276 nonsense probably null
R5331:Negr1 UTSW 3 157069276 nonsense probably null
R5974:Negr1 UTSW 3 157069286 missense probably damaging 1.00
R6560:Negr1 UTSW 3 157312857 missense probably benign
R7506:Negr1 UTSW 3 157069233 nonsense probably null
R7677:Negr1 UTSW 3 157069186 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGAATTTGAAACTGATGTCCC -3'
(R):5'- GCAAACTCAAGTCGTGGTTACTC -3'

Sequencing Primer
(F):5'- ATGTCCCACATCCATGCTTATTATAG -3'
(R):5'- AGGCCTTTGGAGTATGCTT -3'
Posted On2020-06-30