Mutagenetix > Incidental Mutation

Incidental Mutation 'R8080:Tnc'

629269

Institutional Source

Beutler Lab

Gene Symbol

Tnc

Ensembl Gene

ENSMUSG00000028364

Gene Name

tenascin C

Synonyms

TN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8080 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63959785-64047015 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 63976469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 1560 (I1560S)

Ref Sequence

ENSEMBL: ENSMUSP00000030056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107372] [ENSMUST00000107377]

AlphaFold

Q80YX1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030056
AA Change: I1560S

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: I1560S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	3.4e-4	SMART
FN3	1528	1606	1.55e-7	SMART
FN3	1617	1694	1.53e-6	SMART
FN3	1705	1782	7.75e-8	SMART
FBG	1797	2007	4.08e-124	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107372
AA Change: I1651S

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: I1651S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	2.75e0	SMART
FN3	1529	1608	3.4e-4	SMART
FN3	1619	1697	1.55e-7	SMART
FN3	1708	1785	1.53e-6	SMART
FN3	1796	1873	7.75e-8	SMART
FBG	1888	2098	4.08e-124	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107377
AA Change: I1560S

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: I1560S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	3.4e-4	SMART
FN3	1528	1606	1.55e-7	SMART
FN3	1617	1694	1.53e-6	SMART
FN3	1705	1782	7.75e-8	SMART
FBG	1797	2007	4.08e-124	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 94.9%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aloxe3	A	G	11: 69,133,074	Q277R	probably damaging	Het
Anapc5	T	C	5: 122,807,338	N226D	probably damaging	Het
Bcl2l11	T	C	2: 128,128,666	C12R	probably damaging	Het
Bpnt1	A	G	1: 185,352,209	T168A	probably damaging	Het
Brca2	A	T	5: 150,539,892	E1040D	probably benign	Het
Cdca2	G	A	14: 67,677,555	Q752*	probably null	Het
Cntn2	T	C	1: 132,521,798	D635G	probably damaging	Het
Cntnap5b	A	T	1: 100,072,203	I229F	probably benign	Het
Ctr9	G	A	7: 111,051,567	E900K	possibly damaging	Het
Dmbt1	A	G	7: 131,088,770	Y911C	unknown	Het
Egflam	T	A	15: 7,398,080	D2V	probably benign	Het
Enpep	A	T	3: 129,299,134	N505K	probably damaging	Het
Fam13a	A	G	6: 58,956,805	S267P	probably damaging	Het
Fam172a	T	A	13: 78,006,446	L316Q	probably damaging	Het
Fancc	G	T	13: 63,403,023	T12K		Het
Fbxo3	A	G	2: 104,033,667	Y89C	probably damaging	Het
Garem2	A	G	5: 30,108,387	Y83C	probably damaging	Het
Gm17079	T	C	14: 51,693,023	T122A		Het
Gm3696	A	T	14: 7,089,870	L71*	probably null	Het
Gm4559	C	T	7: 142,273,816	R183K	unknown	Het
Gmip	A	T	8: 69,816,086	T454S	possibly damaging	Het
Helz2	T	A	2: 181,238,262	T554S	probably damaging	Het
Hoxc9	C	T	15: 102,982,119	T156M	probably benign	Het
Hrc	A	G	7: 45,336,838	E471G	probably damaging	Het
Hydin	A	G	8: 110,535,231	I2655V	probably benign	Het
Ighv1-64	T	C	12: 115,507,843	H18R	probably benign	Het
Jcad	A	G	18: 4,649,270	Y47C	probably benign	Het
Jmjd4	A	G	11: 59,450,353	T37A	probably benign	Het
Kalrn	C	T	16: 33,975,668	G2915S	possibly damaging	Het
Kdm5d	T	C	Y: 910,742	F285L	probably benign	Het
Lmna	A	G	3: 88,486,561	F237L	probably damaging	Het
Med12l	A	G	3: 59,265,186	K1788E	probably damaging	Het
Mrgprb1	T	C	7: 48,446,910		probably null	Het
Myh1	T	A	11: 67,211,402	Y840N	probably benign	Het
Negr1	C	A	3: 157,160,720	A302E	probably damaging	Het
Nup188	T	C	2: 30,337,033	V1206A	possibly damaging	Het
Nup205	T	C	6: 35,227,376	L1399P	probably damaging	Het
Olfr111	G	A	17: 37,530,664	R229H	probably benign	Het
Olfr1254	T	A	2: 89,788,627	I242F	possibly damaging	Het
Olfr53	T	C	7: 140,652,474	M165T	probably benign	Het
Olfr810	T	C	10: 129,791,128	I154V	probably benign	Het
Olfr892-ps1	T	C	9: 38,190,589	L288S	unknown	Het
Pcdhb4	A	G	18: 37,309,296	D553G	probably benign	Het
Phip	A	G	9: 82,887,609	L1147P	probably damaging	Het
Phlpp1	A	G	1: 106,392,976	D1567G	probably benign	Het
Pigz	T	C	16: 31,942,040	C20R	probably damaging	Het
Plpp1	A	G	13: 112,867,468	K252R	probably benign	Het
Polr2a	A	T	11: 69,735,048	S1759T	unknown	Het
Rbm42	G	T	7: 30,645,711	P212T	unknown	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Slc35e1	G	A	8: 72,492,186	P134L		Het
Slc9a3	A	C	13: 74,166,027	Q818P	probably benign	Het
St3gal4	T	C	9: 35,106,321		probably null	Het
Stard3nl	G	T	13: 19,370,351	A151E	probably damaging	Het
Syt9	T	A	7: 107,436,790	I338N	probably benign	Het
Ticrr	A	T	7: 79,684,264		probably null	Het
Tlr4	T	A	4: 66,839,476	Y169N	probably damaging	Het
Usp7	C	A	16: 8,697,907	D644Y	probably benign	Het
Utp20	A	G	10: 88,782,715	I1141T	possibly damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r60	A	G	7: 42,141,097	M503V	probably benign	Het
Zfp384	T	C	6: 125,036,558	S530P	unknown	Het
Zfp600	T	A	4: 146,196,612	C617S	unknown	Het
Zfp819	A	G	7: 43,617,724	R544G	probably damaging	Het

Other mutations in Tnc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Tnc	APN	4	64016824	splice site	probably benign
IGL00531:Tnc	APN	4	63971153	splice site	probably benign
IGL00674:Tnc	APN	4	63965607	missense	probably damaging	1.00
IGL01015:Tnc	APN	4	64017334	missense	probably benign	0.19
IGL01090:Tnc	APN	4	64000080	missense	probably damaging	1.00
IGL01310:Tnc	APN	4	64013077	missense	probably benign	0.03
IGL01331:Tnc	APN	4	63982875	missense	probably damaging	0.99
IGL01393:Tnc	APN	4	64014054	splice site	probably benign
IGL01411:Tnc	APN	4	64000722	missense	probably damaging	0.96
IGL01472:Tnc	APN	4	64006419	missense	probably benign	0.00
IGL01552:Tnc	APN	4	63970408	missense	probably damaging	1.00
IGL01661:Tnc	APN	4	63970307	splice site	probably benign
IGL01669:Tnc	APN	4	64000701	missense	probably damaging	1.00
IGL01912:Tnc	APN	4	64008740	missense	probably damaging	1.00
IGL02028:Tnc	APN	4	63966672	splice site	probably benign
IGL02100:Tnc	APN	4	64000161	missense	possibly damaging	0.84
IGL02549:Tnc	APN	4	64015072	missense	probably damaging	1.00
IGL02642:Tnc	APN	4	63965579	splice site	probably benign
IGL02712:Tnc	APN	4	63975256	missense	probably damaging	1.00
IGL02876:Tnc	APN	4	64015101	missense	possibly damaging	0.56
IGL02886:Tnc	APN	4	64000107	missense	probably damaging	0.96
IGL02972:Tnc	APN	4	63976478	missense	probably benign	0.11
IGL03073:Tnc	APN	4	63971224	missense	possibly damaging	0.58
IGL03116:Tnc	APN	4	64014033	missense	probably damaging	1.00
IGL03181:Tnc	APN	4	63967306	missense	possibly damaging	0.95
IGL03358:Tnc	APN	4	64017615	nonsense	probably null
tancredo	UTSW	4	63993297	nonsense	probably null
BB009:Tnc	UTSW	4	64008620	missense	probably benign
BB019:Tnc	UTSW	4	64008620	missense	probably benign
P0020:Tnc	UTSW	4	64008857	missense	possibly damaging	0.63
PIT4377001:Tnc	UTSW	4	64017736	missense	probably damaging	1.00
PIT4403001:Tnc	UTSW	4	63964667	missense	probably damaging	1.00
PIT4468001:Tnc	UTSW	4	63964667	missense	probably damaging	1.00
R0243:Tnc	UTSW	4	63970420	missense	probably damaging	0.98
R0362:Tnc	UTSW	4	64017442	missense	probably damaging	1.00
R0410:Tnc	UTSW	4	64007694	missense	probably benign	0.00
R0420:Tnc	UTSW	4	64000159	missense	probably benign	0.00
R0540:Tnc	UTSW	4	64020455	missense	probably damaging	1.00
R0650:Tnc	UTSW	4	64008734	missense	probably benign	0.00
R1019:Tnc	UTSW	4	63962082	missense	probably damaging	1.00
R1102:Tnc	UTSW	4	64020468	missense	probably benign	0.05
R1126:Tnc	UTSW	4	64018120	missense	probably damaging	0.99
R1141:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1142:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1307:Tnc	UTSW	4	64008859	missense	probably damaging	0.98
R1322:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1414:Tnc	UTSW	4	63965695	splice site	probably benign
R1470:Tnc	UTSW	4	63966574	missense	probably damaging	1.00
R1470:Tnc	UTSW	4	63966574	missense	probably damaging	1.00
R1499:Tnc	UTSW	4	63964754	missense	probably benign	0.15
R1506:Tnc	UTSW	4	64007684	missense	possibly damaging	0.90
R1597:Tnc	UTSW	4	64006384	missense	probably benign
R1750:Tnc	UTSW	4	63972735	missense	probably damaging	1.00
R1765:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1783:Tnc	UTSW	4	64018096	missense	probably damaging	0.98
R1808:Tnc	UTSW	4	63999931	missense	probably damaging	1.00
R1903:Tnc	UTSW	4	64000062	missense	probably benign	0.00
R1932:Tnc	UTSW	4	63993025	critical splice donor site	probably null
R1941:Tnc	UTSW	4	64014964	missense	probably damaging	1.00
R1983:Tnc	UTSW	4	63984630	missense	possibly damaging	0.95
R2024:Tnc	UTSW	4	63964621	missense	probably damaging	1.00
R2075:Tnc	UTSW	4	63995666	missense	possibly damaging	0.94
R2327:Tnc	UTSW	4	63975238	missense	possibly damaging	0.78
R2444:Tnc	UTSW	4	64014963	missense	probably damaging	1.00
R2982:Tnc	UTSW	4	64020519	missense	possibly damaging	0.81
R3874:Tnc	UTSW	4	64008710	missense	probably damaging	1.00
R4110:Tnc	UTSW	4	64014951	missense	probably damaging	1.00
R4360:Tnc	UTSW	4	64016924	missense	probably benign	0.35
R4371:Tnc	UTSW	4	63970351	missense	probably damaging	1.00
R4434:Tnc	UTSW	4	64007829	missense	possibly damaging	0.91
R4438:Tnc	UTSW	4	64007829	missense	possibly damaging	0.91
R4570:Tnc	UTSW	4	63995672	missense	probably damaging	0.99
R4595:Tnc	UTSW	4	63995745	missense	probably damaging	1.00
R4749:Tnc	UTSW	4	63995639	missense	possibly damaging	0.56
R4756:Tnc	UTSW	4	63967343	missense	probably damaging	0.99
R4824:Tnc	UTSW	4	64017620	nonsense	probably null
R4957:Tnc	UTSW	4	63976556	missense	probably damaging	1.00
R4977:Tnc	UTSW	4	64006248	missense	possibly damaging	0.82
R5001:Tnc	UTSW	4	63984489	missense	probably damaging	1.00
R5001:Tnc	UTSW	4	64000062	missense	probably benign	0.16
R5015:Tnc	UTSW	4	64006502	missense	probably damaging	1.00
R5049:Tnc	UTSW	4	64017986	missense	probably damaging	1.00
R5066:Tnc	UTSW	4	63975229	missense	probably damaging	0.96
R5073:Tnc	UTSW	4	64020411	missense	probably damaging	1.00
R5116:Tnc	UTSW	4	63967215	critical splice donor site	probably null
R5195:Tnc	UTSW	4	63967252	missense	probably damaging	1.00
R5200:Tnc	UTSW	4	63971278	missense	probably damaging	1.00
R5221:Tnc	UTSW	4	63993297	nonsense	probably null
R5237:Tnc	UTSW	4	63962096	missense	probably damaging	1.00
R5265:Tnc	UTSW	4	63993206	missense	probably benign	0.00
R5275:Tnc	UTSW	4	63964730	nonsense	probably null
R5346:Tnc	UTSW	4	64008655	missense	probably benign
R5409:Tnc	UTSW	4	63966536	missense	probably damaging	1.00
R5409:Tnc	UTSW	4	64007417	missense	probably damaging	1.00
R5469:Tnc	UTSW	4	64013925	splice site	probably null
R5518:Tnc	UTSW	4	64017679	missense	probably damaging	1.00
R5560:Tnc	UTSW	4	64008709	missense	probably damaging	1.00
R5588:Tnc	UTSW	4	64006422	missense	possibly damaging	0.57
R5686:Tnc	UTSW	4	64007730	splice site	probably null
R5686:Tnc	UTSW	4	64008795	missense	possibly damaging	0.78
R5837:Tnc	UTSW	4	64013214	missense	probably damaging	1.00
R5976:Tnc	UTSW	4	64018166	missense	probably benign	0.17
R6156:Tnc	UTSW	4	63970352	missense	probably damaging	1.00
R6182:Tnc	UTSW	4	64008796	missense	probably damaging	0.99
R6360:Tnc	UTSW	4	64000733	missense	probably damaging	1.00
R6416:Tnc	UTSW	4	64007816	missense	probably benign	0.05
R6778:Tnc	UTSW	4	63995598	missense	probably benign	0.12
R6798:Tnc	UTSW	4	63965604	missense	probably benign	0.02
R6799:Tnc	UTSW	4	63965604	missense	probably benign	0.02
R6943:Tnc	UTSW	4	63982745	missense	probably damaging	0.97
R7027:Tnc	UTSW	4	63984589	missense	probably benign	0.02
R7183:Tnc	UTSW	4	64013128	missense	probably damaging	1.00
R7204:Tnc	UTSW	4	63971155	splice site	probably null
R7317:Tnc	UTSW	4	63972722	missense	probably damaging	0.99
R7323:Tnc	UTSW	4	63971232	missense	probably damaging	0.96
R7327:Tnc	UTSW	4	63964762	splice site	probably null
R7382:Tnc	UTSW	4	64014043	nonsense	probably null
R7399:Tnc	UTSW	4	64020657	start gained	probably benign
R7479:Tnc	UTSW	4	64017628	missense	possibly damaging	0.95
R7585:Tnc	UTSW	4	64020411	missense	probably damaging	1.00
R7932:Tnc	UTSW	4	64008620	missense	probably benign
R7947:Tnc	UTSW	4	64017343	missense	probably damaging	1.00
R7974:Tnc	UTSW	4	64000724	missense	possibly damaging	0.84
R7991:Tnc	UTSW	4	64008746	missense	probably benign	0.42
R8004:Tnc	UTSW	4	63984657	missense	probably benign	0.04
R8109:Tnc	UTSW	4	64008763	missense	probably benign	0.11
R8145:Tnc	UTSW	4	64017479	missense	probably benign
R8340:Tnc	UTSW	4	64007799	missense	probably damaging	1.00
R8360:Tnc	UTSW	4	63967274	missense	probably benign	0.00
R8671:Tnc	UTSW	4	64017446	missense	probably damaging	1.00
R8691:Tnc	UTSW	4	63962076	missense	probably damaging	1.00
R8759:Tnc	UTSW	4	64006264	missense	possibly damaging	0.86
R8864:Tnc	UTSW	4	63993059	missense	probably damaging	0.98
R8927:Tnc	UTSW	4	64007358	missense	probably damaging	1.00
R8928:Tnc	UTSW	4	64007358	missense	probably damaging	1.00
R8949:Tnc	UTSW	4	64008850	missense	probably damaging	1.00
R8956:Tnc	UTSW	4	64000733	missense	probably damaging	1.00
R9016:Tnc	UTSW	4	64017094	missense	probably benign	0.23
R9049:Tnc	UTSW	4	64000010	missense	possibly damaging	0.83
R9097:Tnc	UTSW	4	63970385	missense	possibly damaging	0.62
R9114:Tnc	UTSW	4	63972736	missense	probably benign	0.03
R9151:Tnc	UTSW	4	64020449	missense	possibly damaging	0.46
R9488:Tnc	UTSW	4	63995705	missense	probably damaging	0.99
R9537:Tnc	UTSW	4	63966584	missense	probably damaging	0.99
R9666:Tnc	UTSW	4	64007808	missense	probably damaging	1.00
R9700:Tnc	UTSW	4	64014949	missense	probably damaging	0.99
R9703:Tnc	UTSW	4	63971175	missense	probably benign	0.00
R9771:Tnc	UTSW	4	64007363	missense	probably damaging	1.00
S24628:Tnc	UTSW	4	64018012	missense	probably damaging	1.00
Z1177:Tnc	UTSW	4	63960544	critical splice acceptor site	probably null
Z1177:Tnc	UTSW	4	64007426	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTTCTAGATGATCTCAGAAGGAGG -3'
(R):5'- TATTCCTGAGGCTCCGTTCAG -3'

Sequencing Primer
(F):5'- TCTCAGAAGGAGGGAAGTGATTTTC -3'
(R):5'- CTCTAGATACTAAAGGCTCCTGGG -3'

Posted On

2020-06-30