Incidental Mutation 'R8080:Anapc5'
ID629273
Institutional Source Beutler Lab
Gene Symbol Anapc5
Ensembl Gene ENSMUSG00000029472
Gene Nameanaphase-promoting complex subunit 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R8080 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122787459-122821339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122807338 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 226 (N226D)
Ref Sequence ENSEMBL: ENSMUSP00000083393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086216] [ENSMUST00000196423] [ENSMUST00000196640] [ENSMUST00000197074] [ENSMUST00000197719] [ENSMUST00000199406] [ENSMUST00000199926] [ENSMUST00000200645]
Predicted Effect probably damaging
Transcript: ENSMUST00000086216
AA Change: N226D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083393
Gene: ENSMUSG00000029472
AA Change: N226D

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:ANAPC5 239 339 3.5e-34 PFAM
Pfam:ANAPC5 383 478 3.1e-3 PFAM
Blast:TPR 526 559 8e-12 BLAST
Blast:TPR 566 599 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000196423
AA Change: N226D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143169
Gene: ENSMUSG00000029472
AA Change: N226D

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 1.9e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196640
AA Change: N226D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142429
Gene: ENSMUSG00000029472
AA Change: N226D

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 4.8e-31 PFAM
Pfam:Apc5 383 478 5.1e0 PFAM
Blast:TPR 526 559 7e-12 BLAST
Blast:TPR 566 599 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000197074
AA Change: N226D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143053
Gene: ENSMUSG00000029472
AA Change: N226D

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 3.9e-34 PFAM
Pfam:Apc5 375 470 4.1e-3 PFAM
Blast:TPR 518 551 7e-12 BLAST
Blast:TPR 558 591 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000197719
AA Change: N226D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142579
Gene: ENSMUSG00000029472
AA Change: N226D

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 4.7e-31 PFAM
Pfam:Apc5 370 465 5e0 PFAM
Blast:TPR 513 546 7e-12 BLAST
Blast:TPR 553 586 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199406
AA Change: N226D

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142341
Gene: ENSMUSG00000029472
AA Change: N226D

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 4.1e-31 PFAM
Pfam:TPR_10 287 322 2.7e-1 PFAM
Pfam:Apc5 383 478 4.4e0 PFAM
Pfam:TPR_10 533 577 2e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199926
SMART Domains Protein: ENSMUSP00000142981
Gene: ENSMUSG00000029472

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000200645
AA Change: N226D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142922
Gene: ENSMUSG00000029472
AA Change: N226D

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 3.9e-34 PFAM
Pfam:Apc5 370 465 4.1e-3 PFAM
Blast:TPR 513 546 7e-12 BLAST
Blast:TPR 553 586 5e-9 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetratricopeptide repeat-containing component of the anaphase promoting complex/cyclosome (APC/C), a large E3 ubiquitin ligase that controls cell cycle progression by targeting a number of cell cycle regulators such as B-type cyclins for 26S proteasome-mediated degradation through ubiquitination. The encoded protein is required for the proper ubiquitination function of APC/C and for the interaction of APC/C with transcription coactivators. It also interacts with polyA binding protein and represses internal ribosome entry site-mediated translation. Multiple transcript variants encoding different isoforms have been found for this gene. These differences cause translation initiation at a downstream AUG and result in a shorter protein (isoform b), compared to isoform a. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Anapc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Anapc5 APN 5 122800613 missense possibly damaging 0.95
IGL03158:Anapc5 APN 5 122817897 missense probably benign
R0137:Anapc5 UTSW 5 122800632 missense probably damaging 1.00
R0319:Anapc5 UTSW 5 122818856 missense probably damaging 0.99
R0326:Anapc5 UTSW 5 122814604 missense probably benign 0.40
R0399:Anapc5 UTSW 5 122791753 missense probably damaging 0.99
R0633:Anapc5 UTSW 5 122800632 missense probably damaging 1.00
R1173:Anapc5 UTSW 5 122788418 missense possibly damaging 0.49
R1723:Anapc5 UTSW 5 122799343 missense probably damaging 0.96
R2018:Anapc5 UTSW 5 122800524 missense probably damaging 1.00
R2114:Anapc5 UTSW 5 122787938 missense probably benign 0.06
R4211:Anapc5 UTSW 5 122817905 missense probably benign
R4287:Anapc5 UTSW 5 122800601 missense probably benign 0.02
R4533:Anapc5 UTSW 5 122791735 missense possibly damaging 0.86
R4905:Anapc5 UTSW 5 122817910 missense probably benign 0.00
R5336:Anapc5 UTSW 5 122807337 missense probably damaging 1.00
R5499:Anapc5 UTSW 5 122788413 missense probably damaging 1.00
R5568:Anapc5 UTSW 5 122791925 utr 3 prime probably benign
R6481:Anapc5 UTSW 5 122800544 missense probably benign 0.27
R7461:Anapc5 UTSW 5 122818865 missense probably damaging 1.00
R7613:Anapc5 UTSW 5 122818865 missense probably damaging 1.00
R7681:Anapc5 UTSW 5 122802139 missense probably benign 0.01
R7912:Anapc5 UTSW 5 122793435 critical splice donor site probably null
R8007:Anapc5 UTSW 5 122791900 missense probably benign
R8517:Anapc5 UTSW 5 122821030 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTCAAAAGCCATACCAAGGATG -3'
(R):5'- GTTTGGAAAGGTGCTCAGGC -3'

Sequencing Primer
(F):5'- ATACAGTAGCAGGGCCTCTG -3'
(R):5'- TGCTCAGGCTGATGAGGC -3'
Posted On2020-06-30