Incidental Mutation 'R8080:Brca2'
ID629274
Institutional Source Beutler Lab
Gene Symbol Brca2
Ensembl Gene ENSMUSG00000041147
Gene Namebreast cancer 2, early onset
SynonymsFancd1, RAB163
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8080 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location150522630-150570329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150539892 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1040 (E1040D)
Ref Sequence ENSEMBL: ENSMUSP00000144150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]
Predicted Effect probably benign
Transcript: ENSMUST00000044620
AA Change: E1040D

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: E1040D

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202003
SMART Domains Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202313
AA Change: E1040D

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: E1040D

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Brca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Brca2 APN 5 150539898 missense probably benign 0.18
IGL00392:Brca2 APN 5 150541240 missense probably benign 0.02
IGL00557:Brca2 APN 5 150560538 missense probably benign
IGL00798:Brca2 APN 5 150539463 missense probably benign 0.30
IGL00933:Brca2 APN 5 150542404 missense probably benign 0.04
IGL00964:Brca2 APN 5 150532310 missense probably damaging 1.00
IGL01152:Brca2 APN 5 150542390 missense probably damaging 0.99
IGL01577:Brca2 APN 5 150541620 nonsense probably null
IGL01585:Brca2 APN 5 150539516 missense possibly damaging 0.76
IGL01732:Brca2 APN 5 150542387 missense probably benign 0.13
IGL01809:Brca2 APN 5 150531061 splice site probably null
IGL01911:Brca2 APN 5 150567613 missense probably damaging 0.96
IGL02113:Brca2 APN 5 150540979 missense possibly damaging 0.95
IGL02313:Brca2 APN 5 150538661 missense probably damaging 1.00
IGL02342:Brca2 APN 5 150542824 missense possibly damaging 0.94
IGL02508:Brca2 APN 5 150543308 missense possibly damaging 0.85
IGL02532:Brca2 APN 5 150550862 missense probably damaging 1.00
IGL02646:Brca2 APN 5 150560790 missense possibly damaging 0.89
IGL02738:Brca2 APN 5 150567035 missense probably damaging 1.00
IGL02833:Brca2 APN 5 150541790 missense possibly damaging 0.83
IGL02871:Brca2 APN 5 150542552 missense probably benign 0.13
IGL02995:Brca2 APN 5 150529488 missense probably damaging 1.00
IGL03105:Brca2 APN 5 150560485 missense probably benign 0.02
BB007:Brca2 UTSW 5 150558510 missense probably damaging 0.96
BB017:Brca2 UTSW 5 150558510 missense probably damaging 0.96
R0219:Brca2 UTSW 5 150523175 splice site probably benign
R0416:Brca2 UTSW 5 150569392 missense possibly damaging 0.93
R0441:Brca2 UTSW 5 150541857 missense probably damaging 0.96
R0548:Brca2 UTSW 5 150544935 missense probably damaging 0.96
R0745:Brca2 UTSW 5 150544882 splice site probably benign
R0799:Brca2 UTSW 5 150560193 missense probably damaging 0.99
R1165:Brca2 UTSW 5 150542747 missense probably damaging 0.98
R1247:Brca2 UTSW 5 150541274 missense probably damaging 1.00
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1444:Brca2 UTSW 5 150542450 missense probably benign
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1584:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1599:Brca2 UTSW 5 150548713 nonsense probably null
R1600:Brca2 UTSW 5 150560830 splice site probably benign
R1822:Brca2 UTSW 5 150540198 missense probably benign 0.06
R1824:Brca2 UTSW 5 150536922 missense possibly damaging 0.94
R2037:Brca2 UTSW 5 150540669 missense probably benign
R2131:Brca2 UTSW 5 150557129 missense probably damaging 1.00
R2203:Brca2 UTSW 5 150539502 missense possibly damaging 0.58
R2208:Brca2 UTSW 5 150532344 missense probably damaging 0.96
R2293:Brca2 UTSW 5 150560534 missense possibly damaging 0.86
R2517:Brca2 UTSW 5 150539672 missense probably benign 0.04
R2566:Brca2 UTSW 5 150541762 missense probably benign 0.03
R3422:Brca2 UTSW 5 150543121 missense possibly damaging 0.91
R3917:Brca2 UTSW 5 150540827 missense probably damaging 0.96
R3946:Brca2 UTSW 5 150536704 missense probably damaging 0.96
R4176:Brca2 UTSW 5 150539633 nonsense probably null
R4255:Brca2 UTSW 5 150541169 missense possibly damaging 0.92
R4450:Brca2 UTSW 5 150536053 missense probably damaging 0.96
R4603:Brca2 UTSW 5 150536165 missense possibly damaging 0.86
R4681:Brca2 UTSW 5 150552398 splice site probably null
R4755:Brca2 UTSW 5 150559987 splice site probably null
R4762:Brca2 UTSW 5 150531116 missense probably benign 0.00
R4824:Brca2 UTSW 5 150539735 missense probably damaging 1.00
R4887:Brca2 UTSW 5 150556937 missense probably damaging 1.00
R5020:Brca2 UTSW 5 150560436 missense probably damaging 1.00
R5159:Brca2 UTSW 5 150542108 missense possibly damaging 0.93
R5216:Brca2 UTSW 5 150542980 missense probably damaging 0.99
R5269:Brca2 UTSW 5 150539223 missense possibly damaging 0.75
R5274:Brca2 UTSW 5 150539689 missense probably benign 0.00
R5589:Brca2 UTSW 5 150557132 missense possibly damaging 0.67
R5619:Brca2 UTSW 5 150557114 missense probably damaging 0.96
R5641:Brca2 UTSW 5 150556899 missense probably damaging 1.00
R5686:Brca2 UTSW 5 150540904 missense probably benign 0.00
R5730:Brca2 UTSW 5 150569005 missense possibly damaging 0.85
R5763:Brca2 UTSW 5 150548006 missense possibly damaging 0.85
R5877:Brca2 UTSW 5 150543221 missense possibly damaging 0.53
R5893:Brca2 UTSW 5 150569138 missense probably benign 0.02
R5900:Brca2 UTSW 5 150541132 missense probably benign 0.01
R5926:Brca2 UTSW 5 150534622 missense probably benign 0.07
R5966:Brca2 UTSW 5 150543251 missense probably damaging 0.99
R6025:Brca2 UTSW 5 150541575 frame shift probably null
R6062:Brca2 UTSW 5 150556889 missense probably damaging 0.96
R6141:Brca2 UTSW 5 150540637 missense possibly damaging 0.91
R6244:Brca2 UTSW 5 150566978 missense probably benign 0.08
R6508:Brca2 UTSW 5 150536593 missense possibly damaging 0.91
R6519:Brca2 UTSW 5 150540979 missense probably damaging 0.99
R6611:Brca2 UTSW 5 150536193 missense probably damaging 0.99
R6698:Brca2 UTSW 5 150532394 missense probably damaging 1.00
R6856:Brca2 UTSW 5 150540208 missense possibly damaging 0.68
R6912:Brca2 UTSW 5 150541742 missense probably damaging 0.99
R7002:Brca2 UTSW 5 150539918 missense probably benign
R7025:Brca2 UTSW 5 150540478 missense probably benign 0.39
R7151:Brca2 UTSW 5 150541436 missense probably benign 0.12
R7202:Brca2 UTSW 5 150532354 missense probably benign 0.03
R7365:Brca2 UTSW 5 150532337 missense probably damaging 0.99
R7510:Brca2 UTSW 5 150536691 missense possibly damaging 0.85
R7612:Brca2 UTSW 5 150540611 missense probably benign 0.03
R7682:Brca2 UTSW 5 150543153 missense probably benign
R7890:Brca2 UTSW 5 150539381 missense possibly damaging 0.83
R7930:Brca2 UTSW 5 150558510 missense probably damaging 0.96
R7940:Brca2 UTSW 5 150538733 missense probably benign
R8054:Brca2 UTSW 5 150536504 missense probably benign 0.02
R8056:Brca2 UTSW 5 150569306 missense possibly damaging 0.85
R8094:Brca2 UTSW 5 150536169 missense possibly damaging 0.85
R8306:Brca2 UTSW 5 150536663 missense possibly damaging 0.91
R8401:Brca2 UTSW 5 150552352 missense probably damaging 1.00
Z1088:Brca2 UTSW 5 150542763 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGGAGGTAGCTTCAGAACAGC -3'
(R):5'- CAGGCACTTCAGATGTATTCTGTG -3'

Sequencing Primer
(F):5'- TAGCTTCAGAACAGCTTCCAATAAAG -3'
(R):5'- CTGTGTGAATTCAAACTGACTTCCTG -3'
Posted On2020-06-30