Incidental Mutation 'R8080:Gm4559'
ID629287
Institutional Source Beutler Lab
Gene Symbol Gm4559
Ensembl Gene ENSMUSG00000056885
Gene Namepredicted gene 4559
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R8080 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location142273764-142274363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142273816 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 183 (R183K)
Ref Sequence ENSEMBL: ENSMUSP00000079498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080669]
Predicted Effect unknown
Transcript: ENSMUST00000080669
AA Change: R183K
SMART Domains Protein: ENSMUSP00000079498
Gene: ENSMUSG00000056885
AA Change: R183K

DomainStartEndE-ValueType
low complexity region 3 199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Gm4559
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03184:Gm4559 APN 7 142274309 missense unknown
R1493:Gm4559 UTSW 7 142274313 nonsense probably null
R1879:Gm4559 UTSW 7 142274261 missense unknown
R2299:Gm4559 UTSW 7 142273835 missense unknown
R2330:Gm4559 UTSW 7 142274096 missense unknown
R2495:Gm4559 UTSW 7 142273820 missense unknown
R6475:Gm4559 UTSW 7 142274150 missense unknown
R6785:Gm4559 UTSW 7 142274108 missense unknown
R7576:Gm4559 UTSW 7 142273940 missense unknown
R7651:Gm4559 UTSW 7 142273816 missense unknown
R7837:Gm4559 UTSW 7 142273816 missense unknown
R8077:Gm4559 UTSW 7 142273816 missense unknown
R8317:Gm4559 UTSW 7 142273816 small deletion probably benign
R8355:Gm4559 UTSW 7 142273957 missense unknown
R8455:Gm4559 UTSW 7 142273957 missense unknown
W0251:Gm4559 UTSW 7 142273798 missense unknown
Z1177:Gm4559 UTSW 7 142274034 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAAATCTGAGTTGAAGCTGTGG -3'
(R):5'- AAACCCTGCTGCTCTTCAG -3'

Sequencing Primer
(F):5'- CTGAGTTGAAGCTGTGGGAAGC -3'
(R):5'- CTTCAGGCTGTGGGTCTTCC -3'
Posted On2020-06-30