Incidental Mutation 'R0698:Slc2a13'
ID62929
Institutional Source Beutler Lab
Gene Symbol Slc2a13
Ensembl Gene ENSMUSG00000036298
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 13
SynonymsA630029G22Rik
MMRRC Submission 038882-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0698 (G1)
Quality Score162
Status Not validated
Chromosome15
Chromosomal Location91267696-91573261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91321667 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 439 (D439G)
Ref Sequence ENSEMBL: ENSMUSP00000104906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109283]
Predicted Effect probably benign
Transcript: ENSMUST00000109283
AA Change: D439G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104906
Gene: ENSMUSG00000036298
AA Change: D439G

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Pfam:Sugar_tr 73 412 2e-87 PFAM
Pfam:MFS_1 77 411 6.6e-23 PFAM
Pfam:Sugar_tr 487 598 8.1e-28 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 C T 16: 35,290,082 T873M possibly damaging Het
Ap4e1 G A 2: 127,063,363 E985K probably benign Het
Arhgap18 T C 10: 26,912,629 I579T probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Atm T C 9: 53,515,239 E573G probably damaging Het
Baz1b T C 5: 135,198,221 V92A probably damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Cpne4 T C 9: 104,925,795 S213P probably damaging Het
Dock10 T A 1: 80,530,178 Q1672L probably damaging Het
Grm8 C T 6: 27,363,914 C534Y probably damaging Het
Ints7 A G 1: 191,594,464 M183V probably damaging Het
Invs T G 4: 48,396,364 S346A probably benign Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Lrrtm4 T C 6: 80,022,928 L441P probably damaging Het
Map4 C T 9: 110,068,788 R81* probably null Het
Med1 A G 11: 98,155,689 probably benign Het
Necab1 T C 4: 15,005,041 N141S probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Pcdhb2 A T 18: 37,297,366 E797D probably benign Het
Pclo T C 5: 14,712,516 Y3668H unknown Het
Peg10 T A 6: 4,756,835 probably benign Het
Psd2 A G 18: 36,012,711 I723V probably benign Het
Ptprn2 C T 12: 116,722,130 R70* probably null Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab13 C T 3: 90,224,736 T69M probably damaging Het
Rpl32 T C 6: 115,805,590 N126S probably benign Het
Sis C A 3: 72,910,498 A1461S probably damaging Het
Spta1 T C 1: 174,181,104 L258P probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tet2 A T 3: 133,467,384 S1706T probably benign Het
Ttc6 G A 12: 57,673,216 V858I probably benign Het
Vps13c C A 9: 67,889,723 A464E probably benign Het
Zbtb17 T C 4: 141,466,096 probably null Het
Zcchc11 T A 4: 108,555,533 M1477K probably benign Het
Zcwpw1 G A 5: 137,817,521 E429K probably benign Het
Other mutations in Slc2a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Slc2a13 APN 15 91497399 missense probably benign
IGL01295:Slc2a13 APN 15 91350132 critical splice acceptor site probably null
IGL01863:Slc2a13 APN 15 91516492 missense probably benign 0.00
IGL02149:Slc2a13 APN 15 91343721 missense probably benign
IGL02670:Slc2a13 APN 15 91497509 missense probably damaging 0.99
IGL02692:Slc2a13 APN 15 91321658 missense probably benign 0.23
IGL03307:Slc2a13 APN 15 91276114 missense probably damaging 0.98
R0394:Slc2a13 UTSW 15 91516392 missense probably damaging 1.00
R0624:Slc2a13 UTSW 15 91350012 missense possibly damaging 0.89
R0702:Slc2a13 UTSW 15 91321667 missense probably benign
R1052:Slc2a13 UTSW 15 91412160 missense probably damaging 0.96
R2090:Slc2a13 UTSW 15 91516492 missense probably benign 0.00
R2118:Slc2a13 UTSW 15 91516476 missense probably damaging 0.99
R4445:Slc2a13 UTSW 15 91350020 missense possibly damaging 0.46
R4896:Slc2a13 UTSW 15 91412212 missense probably benign 0.20
R6028:Slc2a13 UTSW 15 91276116 missense probably damaging 1.00
R6414:Slc2a13 UTSW 15 91343805 missense probably benign 0.00
R6836:Slc2a13 UTSW 15 91321632 missense probably benign 0.00
R6928:Slc2a13 UTSW 15 91276179 missense probably damaging 1.00
R7353:Slc2a13 UTSW 15 91321604 missense probably benign
R7423:Slc2a13 UTSW 15 91572680 missense probably damaging 1.00
R7458:Slc2a13 UTSW 15 91412187 missense probably benign 0.04
R7641:Slc2a13 UTSW 15 91272156 makesense probably null
R7993:Slc2a13 UTSW 15 91412153 nonsense probably null
R8057:Slc2a13 UTSW 15 91516416 missense probably damaging 0.99
R8164:Slc2a13 UTSW 15 91276078 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAGGCTGAGCTGAGAACTTTTACCC -3'
(R):5'- GCAGCTATCACCTGGATCTGCTTAC -3'

Sequencing Primer
(F):5'- GCTGAGAACTTTTACCCGATGAC -3'
(R):5'- GCTTACATCACTTGTCTTAGCCAAAG -3'
Posted On2013-07-30