Mutagenetix > Incidental Mutation

Incidental Mutation 'R8080:Phip'

629292

Institutional Source

Beutler Lab

Gene Symbol

Phip

Ensembl Gene

ENSMUSG00000032253

Gene Name

pleckstrin homology domain interacting protein

Synonyms

Wdr11, 2810004D21Rik, 4632404O06Rik, Ndrp

MMRRC Submission

Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8080 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

82866159-82975516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 82887609 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1147 (L1147P)

Ref Sequence

ENSEMBL: ENSMUSP00000034787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034787]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034787
AA Change: L1147P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: L1147P

Domain	Start	End	E-Value	Type
WD40	172	211	1.5e-8	SMART
WD40	214	253	4.1e-9	SMART
WD40	256	299	3.5e-7	SMART
WD40	310	349	1.4e-1	SMART
WD40	354	393	6.6e-10	SMART
WD40	408	452	1.4e-2	SMART
WD40	455	495	3.4e-10	SMART
WD40	498	542	6.6e-2	SMART
low complexity region	802	813	N/A	INTRINSIC
low complexity region	841	854	N/A	INTRINSIC
low complexity region	865	877	N/A	INTRINSIC
coiled coil region	881	907	N/A	INTRINSIC
low complexity region	928	941	N/A	INTRINSIC
BROMO	1158	1261	3.5e-11	SMART
BROMO	1318	1423	4.1e-30	SMART
low complexity region	1438	1463	N/A	INTRINSIC
low complexity region	1500	1513	N/A	INTRINSIC
low complexity region	1708	1721	N/A	INTRINSIC
low complexity region	1752	1758	N/A	INTRINSIC

Meta Mutation Damage Score

0.5096

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 94.9%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]

Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aloxe3	A	G	11: 69,133,074	Q277R	probably damaging	Het
Anapc5	T	C	5: 122,807,338	N226D	probably damaging	Het
Bcl2l11	T	C	2: 128,128,666	C12R	probably damaging	Het
Bpnt1	A	G	1: 185,352,209	T168A	probably damaging	Het
Brca2	A	T	5: 150,539,892	E1040D	probably benign	Het
Cdca2	G	A	14: 67,677,555	Q752*	probably null	Het
Cntn2	T	C	1: 132,521,798	D635G	probably damaging	Het
Cntnap5b	A	T	1: 100,072,203	I229F	probably benign	Het
Ctr9	G	A	7: 111,051,567	E900K	possibly damaging	Het
Dmbt1	A	G	7: 131,088,770	Y911C	unknown	Het
Egflam	T	A	15: 7,398,080	D2V	probably benign	Het
Enpep	A	T	3: 129,299,134	N505K	probably damaging	Het
Fam13a	A	G	6: 58,956,805	S267P	probably damaging	Het
Fam172a	T	A	13: 78,006,446	L316Q	probably damaging	Het
Fancc	G	T	13: 63,403,023	T12K		Het
Fbxo3	A	G	2: 104,033,667	Y89C	probably damaging	Het
Garem2	A	G	5: 30,108,387	Y83C	probably damaging	Het
Gm17079	T	C	14: 51,693,023	T122A		Het
Gm3696	A	T	14: 7,089,870	L71*	probably null	Het
Gm4559	C	T	7: 142,273,816	R183K	unknown	Het
Gmip	A	T	8: 69,816,086	T454S	possibly damaging	Het
Helz2	T	A	2: 181,238,262	T554S	probably damaging	Het
Hoxc9	C	T	15: 102,982,119	T156M	probably benign	Het
Hrc	A	G	7: 45,336,838	E471G	probably damaging	Het
Hydin	A	G	8: 110,535,231	I2655V	probably benign	Het
Ighv1-64	T	C	12: 115,507,843	H18R	probably benign	Het
Jcad	A	G	18: 4,649,270	Y47C	probably benign	Het
Jmjd4	A	G	11: 59,450,353	T37A	probably benign	Het
Kalrn	C	T	16: 33,975,668	G2915S	possibly damaging	Het
Kdm5d	T	C	Y: 910,742	F285L	probably benign	Het
Lmna	A	G	3: 88,486,561	F237L	probably damaging	Het
Med12l	A	G	3: 59,265,186	K1788E	probably damaging	Het
Mrgprb1	T	C	7: 48,446,910		probably null	Het
Myh1	T	A	11: 67,211,402	Y840N	probably benign	Het
Negr1	C	A	3: 157,160,720	A302E	probably damaging	Het
Nup188	T	C	2: 30,337,033	V1206A	possibly damaging	Het
Nup205	T	C	6: 35,227,376	L1399P	probably damaging	Het
Olfr111	G	A	17: 37,530,664	R229H	probably benign	Het
Olfr1254	T	A	2: 89,788,627	I242F	possibly damaging	Het
Olfr53	T	C	7: 140,652,474	M165T	probably benign	Het
Olfr810	T	C	10: 129,791,128	I154V	probably benign	Het
Olfr892-ps1	T	C	9: 38,190,589	L288S	unknown	Het
Pcdhb4	A	G	18: 37,309,296	D553G	probably benign	Het
Phlpp1	A	G	1: 106,392,976	D1567G	probably benign	Het
Pigz	T	C	16: 31,942,040	C20R	probably damaging	Het
Plpp1	A	G	13: 112,867,468	K252R	probably benign	Het
Polr2a	A	T	11: 69,735,048	S1759T	unknown	Het
Rbm42	G	T	7: 30,645,711	P212T	unknown	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Slc35e1	G	A	8: 72,492,186	P134L		Het
Slc9a3	A	C	13: 74,166,027	Q818P	probably benign	Het
St3gal4	T	C	9: 35,106,321		probably null	Het
Stard3nl	G	T	13: 19,370,351	A151E	probably damaging	Het
Syt9	T	A	7: 107,436,790	I338N	probably benign	Het
Ticrr	A	T	7: 79,684,264		probably null	Het
Tlr4	T	A	4: 66,839,476	Y169N	probably damaging	Het
Tnc	A	C	4: 63,976,469	I1560S	possibly damaging	Het
Usp7	C	A	16: 8,697,907	D644Y	probably benign	Het
Utp20	A	G	10: 88,782,715	I1141T	possibly damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r60	A	G	7: 42,141,097	M503V	probably benign	Het
Zfp384	T	C	6: 125,036,558	S530P	unknown	Het
Zfp600	T	A	4: 146,196,612	C617S	unknown	Het
Zfp819	A	G	7: 43,617,724	R544G	probably damaging	Het

Other mutations in Phip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Phip	APN	9	82871303	missense	probably damaging	0.99
IGL01510:Phip	APN	9	82913871	missense	probably benign	0.01
IGL01916:Phip	APN	9	82890469	missense	possibly damaging	0.61
IGL02068:Phip	APN	9	82945808	missense	probably damaging	1.00
IGL02089:Phip	APN	9	82871319	missense	probably damaging	1.00
IGL02121:Phip	APN	9	82893370	missense	probably damaging	1.00
IGL02132:Phip	APN	9	82881341	missense	possibly damaging	0.91
IGL02146:Phip	APN	9	82881718	missense	probably benign	0.05
IGL02282:Phip	APN	9	82913690	missense	probably benign	0.09
IGL02341:Phip	APN	9	82932883	missense	probably damaging	1.00
IGL02342:Phip	APN	9	82886692	missense	probably damaging	1.00
IGL02470:Phip	APN	9	82890454	missense	possibly damaging	0.69
IGL02585:Phip	APN	9	82903188	missense	probably benign	0.03
IGL03271:Phip	APN	9	82884824	splice site	probably benign
3-1:Phip	UTSW	9	82886671	missense	probably damaging	1.00
R0102:Phip	UTSW	9	82905792	splice site	probably null
R0102:Phip	UTSW	9	82905792	splice site	probably null
R0137:Phip	UTSW	9	82927191	splice site	probably null
R0268:Phip	UTSW	9	82871288	missense	probably damaging	1.00
R0366:Phip	UTSW	9	82926407	missense	probably damaging	1.00
R0421:Phip	UTSW	9	82926457	missense	probably damaging	1.00
R0481:Phip	UTSW	9	82876716	splice site	probably benign
R0883:Phip	UTSW	9	82876221	missense	probably benign	0.01
R0885:Phip	UTSW	9	82875395	missense	probably benign	0.06
R1300:Phip	UTSW	9	82876747	missense	probably benign	0.00
R1434:Phip	UTSW	9	82959605	missense	probably damaging	0.99
R1448:Phip	UTSW	9	82915423	missense	possibly damaging	0.92
R1588:Phip	UTSW	9	82900828	missense	probably damaging	1.00
R1619:Phip	UTSW	9	82871449	missense	probably benign	0.20
R1658:Phip	UTSW	9	82871498	missense	probably benign
R1688:Phip	UTSW	9	82871657	missense	probably benign
R1773:Phip	UTSW	9	82876189	missense	probably benign
R1865:Phip	UTSW	9	82945792	missense	probably damaging	1.00
R1934:Phip	UTSW	9	82903182	missense	probably benign	0.11
R2070:Phip	UTSW	9	82875299	missense	probably benign
R2096:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2097:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2099:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2192:Phip	UTSW	9	82871815	missense	probably damaging	0.99
R2402:Phip	UTSW	9	82875305	missense	probably benign
R2447:Phip	UTSW	9	82915399	missense	probably damaging	0.99
R2504:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2507:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2508:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R3706:Phip	UTSW	9	82900743	missense	probably benign	0.02
R3829:Phip	UTSW	9	82871645	missense	probably benign
R3846:Phip	UTSW	9	82876126	nonsense	probably null
R4301:Phip	UTSW	9	82959713	nonsense	probably null
R4366:Phip	UTSW	9	82900869	intron	probably benign
R4748:Phip	UTSW	9	82908869	missense	probably benign	0.01
R4895:Phip	UTSW	9	82959595	missense	probably benign	0.20
R5001:Phip	UTSW	9	82896019	splice site	probably null
R5094:Phip	UTSW	9	82871844	missense	probably benign
R5181:Phip	UTSW	9	82871190	utr 3 prime	probably benign
R5194:Phip	UTSW	9	82908862	missense	probably benign	0.03
R5291:Phip	UTSW	9	82945883	missense	probably damaging	1.00
R5335:Phip	UTSW	9	82900756	missense	possibly damaging	0.93
R5458:Phip	UTSW	9	82926500	missense	probably benign	0.40
R5704:Phip	UTSW	9	82871355	missense	probably damaging	0.97
R5866:Phip	UTSW	9	82890150	missense	probably benign
R5870:Phip	UTSW	9	82908677	splice site	probably benign
R5890:Phip	UTSW	9	82906952	missense	probably benign	0.00
R6232:Phip	UTSW	9	82903181	missense	probably benign
R6379:Phip	UTSW	9	82913857	missense	probably damaging	0.98
R6653:Phip	UTSW	9	82900741	nonsense	probably null
R7129:Phip	UTSW	9	82877300	missense	probably damaging	0.98
R7290:Phip	UTSW	9	82871293	missense	possibly damaging	0.94
R7598:Phip	UTSW	9	82905658	missense	possibly damaging	0.94
R7632:Phip	UTSW	9	82903190	missense	probably benign
R7752:Phip	UTSW	9	82890150	missense	probably benign
R7827:Phip	UTSW	9	82908833	missense	probably benign
R7901:Phip	UTSW	9	82890150	missense	probably benign
R7960:Phip	UTSW	9	82893348	missense	probably benign	0.00
R8006:Phip	UTSW	9	82890126	missense	possibly damaging	0.93
R8066:Phip	UTSW	9	82875298	missense	probably benign	0.05
R8135:Phip	UTSW	9	82930374	missense	probably benign	0.09
R8347:Phip	UTSW	9	82908763	missense	probably benign	0.02
R8459:Phip	UTSW	9	82876053	missense	probably benign
R8705:Phip	UTSW	9	82893559	missense	probably damaging	0.99
R8706:Phip	UTSW	9	82905712	missense	possibly damaging	0.89
R8743:Phip	UTSW	9	82927087	missense	probably benign	0.18
R8801:Phip	UTSW	9	82876252	missense	probably benign	0.22
R8930:Phip	UTSW	9	82906988	missense	possibly damaging	0.67
R8932:Phip	UTSW	9	82906988	missense	possibly damaging	0.67
R8969:Phip	UTSW	9	82926964	intron	probably benign
R9064:Phip	UTSW	9	82871487	missense	probably benign	0.20
R9332:Phip	UTSW	9	82875359	missense	probably damaging	0.98
R9335:Phip	UTSW	9	82932926	missense	probably benign	0.03
R9520:Phip	UTSW	9	82871384	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ATGTGTCACGTGATGAGAAAAC -3'
(R):5'- CAGGTATAACTGGAGTGTAGTACAC -3'

Sequencing Primer
(F):5'- TCAAGTCTGTTGAGTGTAAGAAGC -3'
(R):5'- ATGCTTTTTGAGATGCGTTTTATTTG -3'

Posted On

2020-06-30