Incidental Mutation 'R8080:Phip'
ID629292
Institutional Source Beutler Lab
Gene Symbol Phip
Ensembl Gene ENSMUSG00000032253
Gene Namepleckstrin homology domain interacting protein
SynonymsWdr11, 2810004D21Rik, 4632404O06Rik, Ndrp
MMRRC Submission
Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8080 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location82866159-82975516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82887609 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1147 (L1147P)
Ref Sequence ENSEMBL: ENSMUSP00000034787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034787]
Predicted Effect probably damaging
Transcript: ENSMUST00000034787
AA Change: L1147P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: L1147P

DomainStartEndE-ValueType
WD40 172 211 1.5e-8 SMART
WD40 214 253 4.1e-9 SMART
WD40 256 299 3.5e-7 SMART
WD40 310 349 1.4e-1 SMART
WD40 354 393 6.6e-10 SMART
WD40 408 452 1.4e-2 SMART
WD40 455 495 3.4e-10 SMART
WD40 498 542 6.6e-2 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
low complexity region 865 877 N/A INTRINSIC
coiled coil region 881 907 N/A INTRINSIC
low complexity region 928 941 N/A INTRINSIC
BROMO 1158 1261 3.5e-11 SMART
BROMO 1318 1423 4.1e-30 SMART
low complexity region 1438 1463 N/A INTRINSIC
low complexity region 1500 1513 N/A INTRINSIC
low complexity region 1708 1721 N/A INTRINSIC
low complexity region 1752 1758 N/A INTRINSIC
Meta Mutation Damage Score 0.5096 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Phip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phip APN 9 82871303 missense probably damaging 0.99
IGL01510:Phip APN 9 82913871 missense probably benign 0.01
IGL01916:Phip APN 9 82890469 missense possibly damaging 0.61
IGL02068:Phip APN 9 82945808 missense probably damaging 1.00
IGL02089:Phip APN 9 82871319 missense probably damaging 1.00
IGL02121:Phip APN 9 82893370 missense probably damaging 1.00
IGL02132:Phip APN 9 82881341 missense possibly damaging 0.91
IGL02146:Phip APN 9 82881718 missense probably benign 0.05
IGL02282:Phip APN 9 82913690 missense probably benign 0.09
IGL02341:Phip APN 9 82932883 missense probably damaging 1.00
IGL02342:Phip APN 9 82886692 missense probably damaging 1.00
IGL02470:Phip APN 9 82890454 missense possibly damaging 0.69
IGL02585:Phip APN 9 82903188 missense probably benign 0.03
IGL03271:Phip APN 9 82884824 splice site probably benign
3-1:Phip UTSW 9 82886671 missense probably damaging 1.00
R0102:Phip UTSW 9 82905792 splice site probably null
R0102:Phip UTSW 9 82905792 splice site probably null
R0137:Phip UTSW 9 82927191 splice site probably null
R0268:Phip UTSW 9 82871288 missense probably damaging 1.00
R0366:Phip UTSW 9 82926407 missense probably damaging 1.00
R0421:Phip UTSW 9 82926457 missense probably damaging 1.00
R0481:Phip UTSW 9 82876716 splice site probably benign
R0883:Phip UTSW 9 82876221 missense probably benign 0.01
R0885:Phip UTSW 9 82875395 missense probably benign 0.06
R1300:Phip UTSW 9 82876747 missense probably benign 0.00
R1434:Phip UTSW 9 82959605 missense probably damaging 0.99
R1448:Phip UTSW 9 82915423 missense possibly damaging 0.92
R1588:Phip UTSW 9 82900828 missense probably damaging 1.00
R1619:Phip UTSW 9 82871449 missense probably benign 0.20
R1658:Phip UTSW 9 82871498 missense probably benign
R1688:Phip UTSW 9 82871657 missense probably benign
R1773:Phip UTSW 9 82876189 missense probably benign
R1865:Phip UTSW 9 82945792 missense probably damaging 1.00
R1934:Phip UTSW 9 82903182 missense probably benign 0.11
R2070:Phip UTSW 9 82875299 missense probably benign
R2096:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2097:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2099:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2192:Phip UTSW 9 82871815 missense probably damaging 0.99
R2402:Phip UTSW 9 82875305 missense probably benign
R2447:Phip UTSW 9 82915399 missense probably damaging 0.99
R2504:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2507:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2508:Phip UTSW 9 82915339 missense possibly damaging 0.95
R3706:Phip UTSW 9 82900743 missense probably benign 0.02
R3829:Phip UTSW 9 82871645 missense probably benign
R3846:Phip UTSW 9 82876126 nonsense probably null
R4301:Phip UTSW 9 82959713 nonsense probably null
R4366:Phip UTSW 9 82900869 intron probably benign
R4748:Phip UTSW 9 82908869 missense probably benign 0.01
R4895:Phip UTSW 9 82959595 missense probably benign 0.20
R5001:Phip UTSW 9 82896019 splice site probably null
R5094:Phip UTSW 9 82871844 missense probably benign
R5181:Phip UTSW 9 82871190 utr 3 prime probably benign
R5194:Phip UTSW 9 82908862 missense probably benign 0.03
R5291:Phip UTSW 9 82945883 missense probably damaging 1.00
R5335:Phip UTSW 9 82900756 missense possibly damaging 0.93
R5458:Phip UTSW 9 82926500 missense probably benign 0.40
R5704:Phip UTSW 9 82871355 missense probably damaging 0.97
R5866:Phip UTSW 9 82890150 missense probably benign
R5870:Phip UTSW 9 82908677 splice site probably benign
R5890:Phip UTSW 9 82906952 missense probably benign 0.00
R6232:Phip UTSW 9 82903181 missense probably benign
R6379:Phip UTSW 9 82913857 missense probably damaging 0.98
R6653:Phip UTSW 9 82900741 nonsense probably null
R7129:Phip UTSW 9 82877300 missense probably damaging 0.98
R7290:Phip UTSW 9 82871293 missense possibly damaging 0.94
R7598:Phip UTSW 9 82905658 missense possibly damaging 0.94
R7632:Phip UTSW 9 82903190 missense probably benign
R7752:Phip UTSW 9 82890150 missense probably benign
R7827:Phip UTSW 9 82908833 missense probably benign
R7901:Phip UTSW 9 82890150 missense probably benign
R7960:Phip UTSW 9 82893348 missense probably benign 0.00
R8006:Phip UTSW 9 82890126 missense possibly damaging 0.93
R8066:Phip UTSW 9 82875298 missense probably benign 0.05
R8135:Phip UTSW 9 82930374 missense probably benign 0.09
R8347:Phip UTSW 9 82908763 missense probably benign 0.02
R8459:Phip UTSW 9 82876053 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGTCACGTGATGAGAAAAC -3'
(R):5'- CAGGTATAACTGGAGTGTAGTACAC -3'

Sequencing Primer
(F):5'- TCAAGTCTGTTGAGTGTAAGAAGC -3'
(R):5'- ATGCTTTTTGAGATGCGTTTTATTTG -3'
Posted On2020-06-30