Incidental Mutation 'R8080:Polr2a'
ID629298
Institutional Source Beutler Lab
Gene Symbol Polr2a
Ensembl Gene ENSMUSG00000005198
Gene Namepolymerase (RNA) II (DNA directed) polypeptide A
SynonymsRpo2-1, 220kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R8080 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69733997-69758637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69735048 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1759 (S1759T)
Ref Sequence ENSEMBL: ENSMUSP00000050771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058470] [ENSMUST00000071213]
Predicted Effect unknown
Transcript: ENSMUST00000058470
AA Change: S1759T
SMART Domains Protein: ENSMUSP00000050771
Gene: ENSMUSG00000005198
AA Change: S1759T

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 3.6e-39 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 2e-101 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 1.7e-70 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.7e-57 PFAM
Pfam:RNA_pol_Rpb1_R 1555 1568 2.1e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1616 1629 8.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1630 1643 1.9e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1644 1657 2.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1658 1671 2.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1672 1685 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1686 1699 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1700 1713 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1714 1727 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1728 1741 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1742 1755 5.3e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1757 1769 5.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1784 1797 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1798 1811 4.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1826 1839 4.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1841 1853 2e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1854 1867 6.9e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1868 1881 3.7e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1882 1895 1.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1896 1909 5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1924 1936 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1931 1954 2.6e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1948 1960 2.5e-3 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000071213
AA Change: S1721T
SMART Domains Protein: ENSMUSP00000071200
Gene: ENSMUSG00000005198
AA Change: S1721T

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 1.8e-41 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 4.8e-104 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 5.2e-74 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.4e-55 PFAM
low complexity region 1503 1522 N/A INTRINSIC
low complexity region 1524 1549 N/A INTRINSIC
Pfam:RNA_pol_Rpb1_R 1578 1591 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1592 1605 2.5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1606 1619 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1620 1633 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1634 1647 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1648 1661 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1662 1675 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1676 1689 2.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1690 1703 2.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1704 1717 5.2e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1718 1731 5.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1732 1745 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1746 1759 8.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1760 1773 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1788 1801 3.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1802 1815 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1816 1829 8.3e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1830 1843 2.2e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1844 1857 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1858 1871 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1872 1885 6e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1886 1899 4.6e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1893 1909 4.8e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1903 1916 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 1.6e-4 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a reporter allele show prenatal lethality. Homozygotes for a small deletion in the C-terminal domain are viable, fertile and developmentally normal. Homozygotes for a larger deletion show reduced fetal size and partial postnatal lethality; survivors are small but otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Polr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Polr2a APN 11 69743794 splice site probably benign
IGL01067:Polr2a APN 11 69748014 missense possibly damaging 0.94
IGL01547:Polr2a APN 11 69744942 missense probably damaging 0.99
IGL01589:Polr2a APN 11 69741194 missense probably benign
IGL01955:Polr2a APN 11 69741848 missense probably damaging 1.00
IGL02457:Polr2a APN 11 69743250 splice site probably benign
IGL02526:Polr2a APN 11 69739467 missense probably benign 0.03
IGL02792:Polr2a APN 11 69746112 missense probably damaging 0.99
IGL03058:Polr2a APN 11 69745047 splice site probably null
IGL03083:Polr2a APN 11 69745046 critical splice acceptor site probably null
IGL03198:Polr2a APN 11 69747281 splice site probably null
IGL03201:Polr2a APN 11 69745690 nonsense probably null
Leastest UTSW 11 69747292 splice site probably null
PIT4260001:Polr2a UTSW 11 69735967 missense possibly damaging 0.93
R0126:Polr2a UTSW 11 69747425 missense probably damaging 0.99
R0254:Polr2a UTSW 11 69743671 missense possibly damaging 0.75
R0313:Polr2a UTSW 11 69735080 missense unknown
R0336:Polr2a UTSW 11 69736893 missense possibly damaging 0.92
R0453:Polr2a UTSW 11 69741019 missense possibly damaging 0.65
R0762:Polr2a UTSW 11 69735117 missense unknown
R1101:Polr2a UTSW 11 69748071 missense probably benign 0.23
R1509:Polr2a UTSW 11 69747213 missense possibly damaging 0.93
R1547:Polr2a UTSW 11 69734555 missense probably benign 0.39
R1567:Polr2a UTSW 11 69746031 missense probably benign 0.07
R1597:Polr2a UTSW 11 69739929 missense possibly damaging 0.88
R1614:Polr2a UTSW 11 69743373 missense possibly damaging 0.75
R1698:Polr2a UTSW 11 69739877 critical splice donor site probably null
R1735:Polr2a UTSW 11 69742396 missense probably damaging 0.99
R1743:Polr2a UTSW 11 69739503 missense probably damaging 0.96
R1899:Polr2a UTSW 11 69743946 missense probably damaging 0.99
R1900:Polr2a UTSW 11 69743946 missense probably damaging 0.99
R1931:Polr2a UTSW 11 69735375 missense unknown
R2217:Polr2a UTSW 11 69742685 critical splice donor site probably null
R2218:Polr2a UTSW 11 69742685 critical splice donor site probably null
R2245:Polr2a UTSW 11 69735183 missense unknown
R3123:Polr2a UTSW 11 69735710 missense possibly damaging 0.92
R3124:Polr2a UTSW 11 69735710 missense possibly damaging 0.92
R4018:Polr2a UTSW 11 69735059 missense unknown
R4025:Polr2a UTSW 11 69743659 missense possibly damaging 0.95
R4197:Polr2a UTSW 11 69735336 missense unknown
R4462:Polr2a UTSW 11 69746403 missense probably damaging 1.00
R4508:Polr2a UTSW 11 69742559 critical splice acceptor site probably null
R4746:Polr2a UTSW 11 69735674 missense probably benign 0.05
R5069:Polr2a UTSW 11 69736735 splice site probably null
R5102:Polr2a UTSW 11 69746945 missense possibly damaging 0.93
R5195:Polr2a UTSW 11 69744079 missense probably damaging 1.00
R5234:Polr2a UTSW 11 69736840 missense probably benign 0.03
R5330:Polr2a UTSW 11 69747275 missense probably benign 0.01
R5331:Polr2a UTSW 11 69747275 missense probably benign 0.01
R5896:Polr2a UTSW 11 69736260 missense probably damaging 0.99
R5910:Polr2a UTSW 11 69746870 missense probably damaging 0.99
R6128:Polr2a UTSW 11 69736977 missense probably damaging 1.00
R6238:Polr2a UTSW 11 69747221 missense possibly damaging 0.95
R6244:Polr2a UTSW 11 69744226 missense probably damaging 1.00
R6303:Polr2a UTSW 11 69746913 missense probably damaging 1.00
R6338:Polr2a UTSW 11 69739679 splice site probably null
R6361:Polr2a UTSW 11 69743337 missense probably damaging 0.99
R6374:Polr2a UTSW 11 69736932 missense probably damaging 0.98
R6630:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6631:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6633:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6897:Polr2a UTSW 11 69735961 missense probably benign 0.12
R6923:Polr2a UTSW 11 69735961 missense probably benign 0.12
R6933:Polr2a UTSW 11 69736177 missense probably damaging 0.99
R6933:Polr2a UTSW 11 69739467 missense probably benign 0.03
R6953:Polr2a UTSW 11 69741711 missense probably damaging 0.99
R6974:Polr2a UTSW 11 69747200 missense probably damaging 0.98
R7033:Polr2a UTSW 11 69747213 missense possibly damaging 0.93
R7085:Polr2a UTSW 11 69743880 missense probably damaging 0.99
R7112:Polr2a UTSW 11 69735309 missense unknown
R7124:Polr2a UTSW 11 69737462 nonsense probably null
R7307:Polr2a UTSW 11 69747292 splice site probably null
R7319:Polr2a UTSW 11 69746370 missense possibly damaging 0.95
R7350:Polr2a UTSW 11 69741060 missense possibly damaging 0.92
R7369:Polr2a UTSW 11 69745977 missense probably benign 0.01
R7585:Polr2a UTSW 11 69740002 missense probably damaging 0.99
R7882:Polr2a UTSW 11 69736174 missense possibly damaging 0.86
R7935:Polr2a UTSW 11 69747504 missense probably benign 0.00
R8140:Polr2a UTSW 11 69746376 missense probably benign 0.12
R8221:Polr2a UTSW 11 69737518 missense probably benign 0.24
R8245:Polr2a UTSW 11 69739953 missense probably damaging 0.99
R8274:Polr2a UTSW 11 69748056 missense probably damaging 0.99
R8275:Polr2a UTSW 11 69748056 missense probably damaging 0.99
R8276:Polr2a UTSW 11 69748056 missense probably damaging 0.99
R8277:Polr2a UTSW 11 69748056 missense probably damaging 0.99
R8311:Polr2a UTSW 11 69737456 missense probably null 0.20
Predicted Primers PCR Primer
(F):5'- CTGGGACTGTAGCTTGGTGA -3'
(R):5'- CACCGACATCTCCTAGCTACT -3'

Sequencing Primer
(F):5'- AGCTTGGTGTGTAGGTTGGAGAC -3'
(R):5'- GACATCTCCTAGCTACTCCCCAAC -3'
Posted On2020-06-30