Incidental Mutation 'R8080:Hoxc9'
ID629309
Institutional Source Beutler Lab
Gene Symbol Hoxc9
Ensembl Gene ENSMUSG00000036139
Gene Namehomeobox C9
SynonymsHox-3.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8080 (G1)
Quality Score180.009
Status Validated
Chromosome15
Chromosomal Location102976439-102985099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102982119 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 156 (T156M)
Ref Sequence ENSEMBL: ENSMUSP00000001706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001706] [ENSMUST00000173306]
Predicted Effect probably benign
Transcript: ENSMUST00000001706
AA Change: T156M

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000001706
Gene: ENSMUSG00000036139
AA Change: T156M

DomainStartEndE-ValueType
Pfam:Hox9_act 1 179 2e-63 PFAM
HOX 192 254 8.84e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173306
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene grow more slowly than normal and develop hunched backs. Forward transformations seen in vertebrae from L1 and forward to around T10. Abnormalities in the sternum and ribs attachments to the sternum are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Hoxc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Hoxc9 APN 15 102984000 missense probably damaging 1.00
IGL01418:Hoxc9 APN 15 102984000 missense probably damaging 1.00
IGL03031:Hoxc9 APN 15 102984090 missense probably damaging 1.00
R0498:Hoxc9 UTSW 15 102983927 missense probably damaging 1.00
R1436:Hoxc9 UTSW 15 102981872 missense probably benign 0.03
R2059:Hoxc9 UTSW 15 102984123 missense probably benign 0.01
R2414:Hoxc9 UTSW 15 102984108 missense probably damaging 1.00
R2900:Hoxc9 UTSW 15 102981753 missense probably benign 0.00
R3807:Hoxc9 UTSW 15 102981684 missense possibly damaging 0.94
R3821:Hoxc9 UTSW 15 102982164 missense probably benign 0.32
R4824:Hoxc9 UTSW 15 102981793 nonsense probably null
R5165:Hoxc9 UTSW 15 102984000 missense probably damaging 1.00
R5700:Hoxc9 UTSW 15 102981881 missense possibly damaging 0.65
R5701:Hoxc9 UTSW 15 102981881 missense possibly damaging 0.65
R6003:Hoxc9 UTSW 15 102981879 missense probably benign 0.15
R6145:Hoxc9 UTSW 15 102983959 missense probably damaging 1.00
R6570:Hoxc9 UTSW 15 102981753 missense probably benign 0.00
R7312:Hoxc9 UTSW 15 102982161 missense probably benign 0.02
R7434:Hoxc9 UTSW 15 102983982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTATCACCCTTACGGC -3'
(R):5'- CCCCAAGGTAATTCGCTTTTATTG -3'

Sequencing Primer
(F):5'- TACATGCGGACTTGGCTC -3'
(R):5'- AGGTAATTCGCTTTTATTGAGTCCTC -3'
Posted On2020-06-30