Incidental Mutation 'R8080:Pcdhb4'
ID629316
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Nameprotocadherin beta 4
SynonymsPcdhbD, Pcdhb5A
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_053129.3; MGI:2136738

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8080 (G1)
Quality Score218.009
Status Validated
Chromosome18
Chromosomal Location37307455-37311172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37309296 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 553 (D553G)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056712
AA Change: D553G

PolyPhen 2 Score 0.420 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: D553G

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37309916 missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37308513 missense probably benign
IGL01325:Pcdhb4 APN 18 37309623 missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37308750 missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37309014 missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37309004 missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37307682 missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37309668 missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37309977 missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37308516 missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37308885 missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37309215 missense probably damaging 1.00
R0611:Pcdhb4 UTSW 18 37308210 missense probably damaging 1.00
R0671:Pcdhb4 UTSW 18 37307742 missense probably benign 0.01
R0738:Pcdhb4 UTSW 18 37308711 missense probably damaging 1.00
R0853:Pcdhb4 UTSW 18 37309885 nonsense probably null
R0893:Pcdhb4 UTSW 18 37309370 splice site probably null
R1932:Pcdhb4 UTSW 18 37309541 missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37308868 missense probably damaging 1.00
R2194:Pcdhb4 UTSW 18 37308735 missense probably damaging 1.00
R2273:Pcdhb4 UTSW 18 37308926 missense probably damaging 1.00
R3807:Pcdhb4 UTSW 18 37309314 missense probably damaging 0.98
R3815:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37308848 missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37309964 missense probably benign
R4606:Pcdhb4 UTSW 18 37308652 missense probably damaging 1.00
R4615:Pcdhb4 UTSW 18 37308500 missense probably benign 0.02
R4840:Pcdhb4 UTSW 18 37308399 missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37309926 missense possibly damaging 0.78
R5272:Pcdhb4 UTSW 18 37307766 missense probably benign 0.04
R5586:Pcdhb4 UTSW 18 37308981 missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37308989 missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37309566 missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37308429 missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37308021 missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37309572 missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37308782 missense possibly damaging 0.95
R7204:Pcdhb4 UTSW 18 37309239 missense probably damaging 1.00
R7271:Pcdhb4 UTSW 18 37308169 missense possibly damaging 0.89
R7436:Pcdhb4 UTSW 18 37309275 missense probably damaging 1.00
R7444:Pcdhb4 UTSW 18 37309452 missense probably damaging 1.00
R7614:Pcdhb4 UTSW 18 37309549 missense probably benign 0.40
R7650:Pcdhb4 UTSW 18 37309614 missense probably damaging 1.00
R7664:Pcdhb4 UTSW 18 37309240 missense probably damaging 1.00
R8087:Pcdhb4 UTSW 18 37308664 missense probably damaging 1.00
R8115:Pcdhb4 UTSW 18 37309400 missense probably damaging 0.99
Z1177:Pcdhb4 UTSW 18 37309913 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAGTGCCACAGACTCAGAC -3'
(R):5'- AACCTGTGCTTGGGTGCATC -3'

Sequencing Primer
(F):5'- ACTCAGACTCGGGCTCCAATG -3'
(R):5'- CTTGGGTGCATCTCGCTCG -3'
Posted On2020-06-30