Incidental Mutation 'R8081:Mcm6'
ID629318
Institutional Source Beutler Lab
Gene Symbol Mcm6
Ensembl Gene ENSMUSG00000026355
Gene Nameminichromosome maintenance complex component 6
SynonymsD1Wsu22e, Mcmd6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location128331590-128359664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128338168 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 622 (E622G)
Ref Sequence ENSEMBL: ENSMUSP00000027601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000190495]
Predicted Effect probably damaging
Transcript: ENSMUST00000027601
AA Change: E622G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355
AA Change: E622G

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 821 1e-47 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000190495
AA Change: E622G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355
AA Change: E622G

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 783 3e-29 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Mcm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Mcm6 APN 1 128344383 missense probably damaging 1.00
IGL01420:Mcm6 APN 1 128345875 missense probably damaging 1.00
IGL01746:Mcm6 APN 1 128353524 nonsense probably null
IGL02256:Mcm6 APN 1 128335728 critical splice donor site probably null
IGL02624:Mcm6 APN 1 128349448 missense possibly damaging 0.91
IGL02732:Mcm6 APN 1 128359490 missense probably benign 0.16
IGL02750:Mcm6 APN 1 128343472 missense probably damaging 1.00
IGL02926:Mcm6 APN 1 128339382 missense probably damaging 1.00
IGL03189:Mcm6 APN 1 128344302 missense probably damaging 1.00
IGL03238:Mcm6 APN 1 128355520 missense probably benign 0.13
IGL03397:Mcm6 APN 1 128344302 missense probably damaging 1.00
R0453:Mcm6 UTSW 1 128333555 missense probably benign 0.00
R0501:Mcm6 UTSW 1 128355636 missense probably benign 0.03
R0885:Mcm6 UTSW 1 128348933 missense probably benign 0.00
R1013:Mcm6 UTSW 1 128349041 missense probably benign
R1319:Mcm6 UTSW 1 128349052 missense probably benign
R1396:Mcm6 UTSW 1 128351476 missense probably damaging 1.00
R1656:Mcm6 UTSW 1 128349418 missense possibly damaging 0.90
R1891:Mcm6 UTSW 1 128335810 missense probably damaging 1.00
R1950:Mcm6 UTSW 1 128345989 missense probably benign 0.35
R3411:Mcm6 UTSW 1 128351585 missense probably benign 0.35
R4564:Mcm6 UTSW 1 128343459 missense probably damaging 1.00
R4626:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4627:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4628:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4916:Mcm6 UTSW 1 128348977 missense probably damaging 1.00
R4965:Mcm6 UTSW 1 128359486 missense probably damaging 1.00
R4967:Mcm6 UTSW 1 128335849 missense probably damaging 1.00
R5016:Mcm6 UTSW 1 128343427 missense probably damaging 1.00
R5204:Mcm6 UTSW 1 128333638 missense probably benign 0.01
R5229:Mcm6 UTSW 1 128333584 missense possibly damaging 0.82
R5607:Mcm6 UTSW 1 128355589 missense probably damaging 1.00
R5811:Mcm6 UTSW 1 128335728 critical splice donor site probably benign
R5816:Mcm6 UTSW 1 128348455 missense probably benign 0.01
R7204:Mcm6 UTSW 1 128338127 missense probably damaging 1.00
R7316:Mcm6 UTSW 1 128359508 missense probably damaging 1.00
R8546:Mcm6 UTSW 1 128345948 missense possibly damaging 0.91
R8547:Mcm6 UTSW 1 128345948 missense possibly damaging 0.91
R8549:Mcm6 UTSW 1 128345948 missense possibly damaging 0.91
R8785:Mcm6 UTSW 1 128334798 missense probably benign 0.15
R8878:Mcm6 UTSW 1 128355511 critical splice donor site probably null
Z1088:Mcm6 UTSW 1 128344298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTATTAGTCTAGACAGCATACC -3'
(R):5'- GCCCTCTGTTTCCTGGAGTG -3'

Sequencing Primer
(F):5'- CCTATGATAGCAACCTTTTTACTGGG -3'
(R):5'- GGAGTGCTTCCATCCAGG -3'
Posted On2020-06-30