Incidental Mutation 'R8081:Opn3'
ID629319
Institutional Source Beutler Lab
Gene Symbol Opn3
Ensembl Gene ENSMUSG00000026525
Gene Nameopsin 3
SynonymsEcpn, encephalopsin, panopsin, ERO
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location175662421-175692776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 175665569 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 143 (H143L)
Ref Sequence ENSEMBL: ENSMUSP00000027809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027809] [ENSMUST00000040250] [ENSMUST00000097458]
Predicted Effect probably damaging
Transcript: ENSMUST00000027809
AA Change: H143L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027809
Gene: ENSMUSG00000026525
AA Change: H143L

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7tm_1 56 307 4.7e-36 PFAM
low complexity region 314 331 N/A INTRINSIC
low complexity region 363 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040250
SMART Domains Protein: ENSMUSP00000038914
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.6e-22 PFAM
Pfam:NAD_binding_8 13 63 2.2e-7 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097458
SMART Domains Protein: ENSMUSP00000095067
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.8e-22 PFAM
Pfam:NAD_binding_8 13 63 2.1e-7 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. In addition to the visual opsins, mammals possess several photoreceptive non-visual opsins that are expressed in extraocular tissues. This gene, opsin 3, is strongly expressed in brain and testis and weakly expressed in liver, placenta, heart, lung, skeletal muscle, kidney, and pancreas. The gene may also be expressed in the retina. The protein has the canonical features of a photoreceptive opsin protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice exhibit normal photoentrainment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Opn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0349:Opn3 UTSW 1 175692304 missense probably damaging 1.00
R0377:Opn3 UTSW 1 175663694 missense probably damaging 1.00
R2040:Opn3 UTSW 1 175663579 missense possibly damaging 0.73
R2351:Opn3 UTSW 1 175692511 missense probably benign
R4868:Opn3 UTSW 1 175663561 missense probably damaging 1.00
R5561:Opn3 UTSW 1 175665587 missense probably damaging 1.00
R6232:Opn3 UTSW 1 175663103 missense probably damaging 0.99
R6848:Opn3 UTSW 1 175663049 missense probably damaging 1.00
R7275:Opn3 UTSW 1 175665473 missense probably damaging 1.00
R7522:Opn3 UTSW 1 175665623 missense probably benign 0.08
R7774:Opn3 UTSW 1 175662905 missense probably damaging 0.99
Z1177:Opn3 UTSW 1 175692663 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GAATGTGGCCGTAGCAATG -3'
(R):5'- TTCTAGAGCATCCCATTGGCC -3'

Sequencing Primer
(F):5'- GCTATGATGCCCACGGG -3'
(R):5'- GGCCTCAGATTCTCTGTACAGTG -3'
Posted On2020-06-30