Incidental Mutation 'R8081:Klhl5'
ID629328
Institutional Source Beutler Lab
Gene Symbol Klhl5
Ensembl Gene ENSMUSG00000054920
Gene Namekelch-like 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65107539-65168188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65162925 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 607 (N607K)
Ref Sequence ENSEMBL: ENSMUSP00000098752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101191] [ENSMUST00000203538] [ENSMUST00000204097] [ENSMUST00000204348]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101191
AA Change: N607K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098752
Gene: ENSMUSG00000054920
AA Change: N607K

DomainStartEndE-ValueType
low complexity region 114 137 N/A INTRINSIC
BTB 173 270 1.5e-28 SMART
BACK 275 376 7.85e-36 SMART
Kelch 421 467 1.12e-11 SMART
Kelch 468 514 3.2e-16 SMART
Kelch 515 561 1.51e-12 SMART
Kelch 562 608 4.6e-17 SMART
Kelch 609 661 2.84e-8 SMART
Kelch 662 708 1.83e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203538
AA Change: N232K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145269
Gene: ENSMUSG00000054920
AA Change: N232K

DomainStartEndE-ValueType
Kelch 46 92 3.7e-14 SMART
Kelch 93 139 1.1e-18 SMART
Kelch 140 186 5.1e-15 SMART
Kelch 187 233 1.5e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204097
AA Change: N467K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144976
Gene: ENSMUSG00000054920
AA Change: N467K

DomainStartEndE-ValueType
BTB 33 130 1.5e-28 SMART
BACK 135 236 7.85e-36 SMART
Kelch 281 327 1.12e-11 SMART
Kelch 328 374 3.2e-16 SMART
Kelch 375 421 1.51e-12 SMART
Kelch 422 468 4.6e-17 SMART
Kelch 469 521 2.84e-8 SMART
Kelch 522 568 1.83e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000204348
AA Change: N546K
SMART Domains Protein: ENSMUSP00000144732
Gene: ENSMUSG00000054920
AA Change: N546K

DomainStartEndE-ValueType
BTB 111 209 1.32e-15 SMART
BACK 214 315 7.85e-36 SMART
Kelch 360 406 1.12e-11 SMART
Kelch 407 453 3.2e-16 SMART
Kelch 454 500 1.51e-12 SMART
Kelch 501 547 4.6e-17 SMART
Kelch 548 600 2.84e-8 SMART
Kelch 601 647 1.83e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Klhl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Klhl5 APN 5 65148800 missense probably damaging 0.98
IGL02700:Klhl5 APN 5 65131430 nonsense probably null
R0064:Klhl5 UTSW 5 65141288 missense probably benign 0.13
R0142:Klhl5 UTSW 5 65143350 nonsense probably null
R0783:Klhl5 UTSW 5 65156253 splice site probably benign
R0828:Klhl5 UTSW 5 65162792 missense probably damaging 1.00
R1160:Klhl5 UTSW 5 65141340 missense probably benign 0.13
R1181:Klhl5 UTSW 5 65162885 missense probably damaging 0.99
R1611:Klhl5 UTSW 5 65164649 missense probably benign 0.00
R1903:Klhl5 UTSW 5 65166987 missense probably benign 0.37
R4880:Klhl5 UTSW 5 65158901 missense probably damaging 1.00
R4961:Klhl5 UTSW 5 65152690 intron probably benign
R5204:Klhl5 UTSW 5 65131438 missense possibly damaging 0.95
R5389:Klhl5 UTSW 5 65141282 missense possibly damaging 0.76
R5921:Klhl5 UTSW 5 65162956 missense probably damaging 0.96
R6769:Klhl5 UTSW 5 65164652 missense probably damaging 1.00
R6771:Klhl5 UTSW 5 65164652 missense probably damaging 1.00
R7008:Klhl5 UTSW 5 65143249 missense probably benign 0.02
R7214:Klhl5 UTSW 5 65131755 missense probably benign
R7227:Klhl5 UTSW 5 65141288 missense probably benign 0.00
R7239:Klhl5 UTSW 5 65161186 missense probably damaging 1.00
R7400:Klhl5 UTSW 5 65148590 missense possibly damaging 0.81
R7796:Klhl5 UTSW 5 65164622 missense probably damaging 1.00
R8108:Klhl5 UTSW 5 65148587 critical splice acceptor site probably null
R8185:Klhl5 UTSW 5 65156128 missense probably damaging 0.99
R8424:Klhl5 UTSW 5 65162962 missense probably benign 0.10
R8691:Klhl5 UTSW 5 65149538 intron probably benign
R8818:Klhl5 UTSW 5 65148646 missense probably benign 0.23
X0009:Klhl5 UTSW 5 65162921 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAAAGTCAGCGAACTGTCACAGC -3'
(R):5'- TGGAGACCACACTGATGGAC -3'

Sequencing Primer
(F):5'- GTCACAGCAATAGCCTGTTG -3'
(R):5'- GATGGACACTCACTAGTCTTATGAC -3'
Posted On2020-06-30