Incidental Mutation 'R8081:Cux2'
ID629330
Institutional Source Beutler Lab
Gene Symbol Cux2
Ensembl Gene ENSMUSG00000042589
Gene Namecut-like homeobox 2
SynonymsCutl2, Cux-2, ENSMUSG00000072641, 1700051K22Rik, Cux2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R8081 (G1)
Quality Score172.009
Status Not validated
Chromosome5
Chromosomal Location121856366-122050102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121869456 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 714 (I714T)
Ref Sequence ENSEMBL: ENSMUSP00000083497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086317] [ENSMUST00000111752] [ENSMUST00000168288]
Predicted Effect probably benign
Transcript: ENSMUST00000086317
AA Change: I714T

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083497
Gene: ENSMUSG00000042589
AA Change: I714T

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111752
AA Change: I714T

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107381
Gene: ENSMUSG00000042589
AA Change: I714T

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168288
AA Change: I714T

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130302
Gene: ENSMUSG00000042589
AA Change: I714T

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the Cut family of transcription factors that have multiple DNA binding domains and regulate cell proliferation and differentiation. This gene is primarily expressed in nervous tissues where it controls the proliferation of neuronal precursors, and may play a role in organogenesis earlier during embryonic development. Mice lacking the encoded protein exhibit smaller spinal cords with deficits in neural progenitor development as well as in neuroblast and interneuron differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various neural defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Cux2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Cux2 APN 5 121868538 missense possibly damaging 0.92
IGL00917:Cux2 APN 5 121869105 missense probably null 0.05
IGL00979:Cux2 APN 5 121873714 missense probably damaging 0.98
IGL01069:Cux2 APN 5 121867351 missense possibly damaging 0.84
IGL01303:Cux2 APN 5 121865928 missense probably benign 0.03
IGL01583:Cux2 APN 5 121874107 missense probably damaging 0.98
IGL01762:Cux2 APN 5 121873145 missense probably damaging 1.00
IGL02508:Cux2 APN 5 121860822 missense possibly damaging 0.93
R0333:Cux2 UTSW 5 121860608 missense probably benign 0.04
R0352:Cux2 UTSW 5 121884739 splice site probably benign
R0443:Cux2 UTSW 5 121887437 missense possibly damaging 0.66
R1853:Cux2 UTSW 5 121869121 missense possibly damaging 0.95
R2011:Cux2 UTSW 5 121861326 missense probably benign 0.21
R2057:Cux2 UTSW 5 121869504 missense probably benign 0.02
R2165:Cux2 UTSW 5 121887477 missense possibly damaging 0.78
R3964:Cux2 UTSW 5 121887476 nonsense probably null
R4182:Cux2 UTSW 5 121868492 missense probably damaging 1.00
R4579:Cux2 UTSW 5 121860653 missense probably benign 0.01
R4655:Cux2 UTSW 5 121885934 missense possibly damaging 0.95
R4673:Cux2 UTSW 5 121887476 nonsense probably null
R4697:Cux2 UTSW 5 121873753 missense probably damaging 1.00
R4927:Cux2 UTSW 5 121877089 missense probably benign 0.13
R5348:Cux2 UTSW 5 121865978 missense probably damaging 0.99
R6208:Cux2 UTSW 5 121860822 missense possibly damaging 0.93
R6500:Cux2 UTSW 5 121864726 missense probably benign 0.03
R6661:Cux2 UTSW 5 121869297 missense probably benign 0.04
R6986:Cux2 UTSW 5 121868579 missense possibly damaging 0.84
R7296:Cux2 UTSW 5 121861256 missense probably benign 0.25
R7561:Cux2 UTSW 5 121879868 missense probably benign 0.31
R7702:Cux2 UTSW 5 121868585 missense possibly damaging 0.70
R7705:Cux2 UTSW 5 121869673 missense probably benign 0.13
R7791:Cux2 UTSW 5 121867099 missense probably benign 0.10
R7998:Cux2 UTSW 5 121868585 missense possibly damaging 0.70
R8096:Cux2 UTSW 5 121869097 missense possibly damaging 0.70
R8191:Cux2 UTSW 5 121874154 missense probably benign 0.31
R8794:Cux2 UTSW 5 121869243 missense probably benign 0.31
R8957:Cux2 UTSW 5 121860948 missense probably benign 0.36
X0027:Cux2 UTSW 5 121884751 missense probably benign 0.13
Z1176:Cux2 UTSW 5 121873813 nonsense probably null
Z1176:Cux2 UTSW 5 121885934 missense probably benign 0.02
Z1177:Cux2 UTSW 5 121873680 missense probably damaging 1.00
Z1177:Cux2 UTSW 5 121877129 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATAGCTGCTTCGTCCTCAGG -3'
(R):5'- AACATTCTGGAACAAGCCCG -3'

Sequencing Primer
(F):5'- CCTCAGGGGCGATGGTTG -3'
(R):5'- AGATGGAGTCGGGTCCCAG -3'
Posted On2020-06-30