Incidental Mutation 'R8081:Fuk'
ID629350
Institutional Source Beutler Lab
Gene Symbol Fuk
Ensembl Gene ENSMUSG00000033703
Gene Namefucokinase
SynonymsL-fucose kinase, 1110046B12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location110882456-110902488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110889151 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 515 (R515S)
Ref Sequence ENSEMBL: ENSMUSP00000039271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041382] [ENSMUST00000212971]
Predicted Effect probably benign
Transcript: ENSMUST00000041382
AA Change: R515S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039271
Gene: ENSMUSG00000033703
AA Change: R515S

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Pfam:Fucokinase 94 496 1.7e-101 PFAM
low complexity region 807 821 N/A INTRINSIC
Pfam:GHMP_kinases_N 827 894 3.6e-9 PFAM
Pfam:GHMP_kinases_C 970 1052 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212971
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature of only one has been described to date. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Fuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Fuk APN 8 110890476 missense possibly damaging 0.75
IGL01963:Fuk APN 8 110893402 missense probably damaging 1.00
IGL01986:Fuk APN 8 110883257 missense probably benign
PIT4283001:Fuk UTSW 8 110887432 missense probably benign 0.05
R0008:Fuk UTSW 8 110884233 splice site probably benign
R0032:Fuk UTSW 8 110892103 missense possibly damaging 0.55
R0032:Fuk UTSW 8 110892103 missense possibly damaging 0.55
R0057:Fuk UTSW 8 110893768 splice site probably benign
R0057:Fuk UTSW 8 110893768 splice site probably benign
R0280:Fuk UTSW 8 110894748 missense probably damaging 1.00
R0285:Fuk UTSW 8 110893717 missense probably benign 0.08
R0359:Fuk UTSW 8 110893259 splice site probably null
R0587:Fuk UTSW 8 110883325 missense probably damaging 0.98
R1528:Fuk UTSW 8 110883241 missense probably damaging 1.00
R1731:Fuk UTSW 8 110894823 missense probably damaging 0.96
R1907:Fuk UTSW 8 110893378 nonsense probably null
R2152:Fuk UTSW 8 110889072 missense probably benign 0.03
R2154:Fuk UTSW 8 110889072 missense probably benign 0.03
R2392:Fuk UTSW 8 110889724 missense probably benign
R3037:Fuk UTSW 8 110894718 splice site probably null
R3714:Fuk UTSW 8 110887259 missense probably damaging 1.00
R3765:Fuk UTSW 8 110887104 missense probably benign 0.00
R4307:Fuk UTSW 8 110892080 nonsense probably null
R4404:Fuk UTSW 8 110890301 missense probably benign 0.03
R4768:Fuk UTSW 8 110892134 missense probably benign 0.00
R4998:Fuk UTSW 8 110887803 missense probably damaging 0.96
R5009:Fuk UTSW 8 110887830 missense probably damaging 0.99
R5253:Fuk UTSW 8 110883867 missense possibly damaging 0.90
R6257:Fuk UTSW 8 110890545 missense probably benign 0.00
R6430:Fuk UTSW 8 110884116 missense probably benign 0.16
R6536:Fuk UTSW 8 110883879 missense possibly damaging 0.47
R6599:Fuk UTSW 8 110893283 splice site probably null
R6799:Fuk UTSW 8 110893418 missense probably benign
R7051:Fuk UTSW 8 110890339 missense probably damaging 0.97
R7184:Fuk UTSW 8 110887156 missense probably damaging 1.00
R7241:Fuk UTSW 8 110895897 missense probably benign
R7448:Fuk UTSW 8 110890331 missense possibly damaging 0.93
R8094:Fuk UTSW 8 110895972 missense probably damaging 1.00
R8692:Fuk UTSW 8 110889090 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTGTCAAGTGTGGCCAGCAG -3'
(R):5'- CCTATGAGTTGACCAATAGGCTTG -3'

Sequencing Primer
(F):5'- CCCGGATCAGTGGACGTAG -3'
(R):5'- GCAGGGCCCTTAGCTTTC -3'
Posted On2020-06-30