Incidental Mutation 'R8081:Slc38a8'
ID629351
Institutional Source Beutler Lab
Gene Symbol Slc38a8
Ensembl Gene ENSMUSG00000034224
Gene Namesolute carrier family 38, member 8
SynonymsLOC234788
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8081 (G1)
Quality Score181.009
Status Not validated
Chromosome8
Chromosomal Location119479602-119501698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119485530 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 358 (M358K)
Ref Sequence ENSEMBL: ENSMUSP00000038438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036748]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036748
AA Change: M358K

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038438
Gene: ENSMUSG00000034224
AA Change: M358K

DomainStartEndE-ValueType
Pfam:Aa_trans 22 429 3.7e-58 PFAM
Pfam:Trp_Tyr_perm 23 264 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative sodium-dependent amino-acid/proton antiporter. The protein has eleven transmembrane domains, an extracellular N-terminus and an intracellular C-terminal tail. The protein is a member of the SLC38 sodium-coupled neutral amino acid transporter family of proteins. Mutations in this gene result in foveal hypoplasia with or without optic nerve misrouting and/or anterior segment dysgenesis. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Slc38a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc38a8 APN 8 119494219 missense probably benign 0.01
IGL02167:Slc38a8 APN 8 119487360 missense probably benign 0.03
IGL02565:Slc38a8 APN 8 119485561 missense probably damaging 1.00
IGL02899:Slc38a8 APN 8 119485543 missense probably benign 0.34
IGL03177:Slc38a8 APN 8 119485512 missense probably damaging 1.00
IGL03282:Slc38a8 APN 8 119499716 missense probably damaging 0.99
R1109:Slc38a8 UTSW 8 119482655 missense probably benign
R1116:Slc38a8 UTSW 8 119496133 missense probably damaging 1.00
R2247:Slc38a8 UTSW 8 119485650 missense probably benign 0.00
R4964:Slc38a8 UTSW 8 119482684 splice site probably null
R5294:Slc38a8 UTSW 8 119494289 missense probably damaging 1.00
R5303:Slc38a8 UTSW 8 119486041 missense possibly damaging 0.66
R5430:Slc38a8 UTSW 8 119494220 missense probably benign 0.16
R5643:Slc38a8 UTSW 8 119480749 makesense probably null
R6016:Slc38a8 UTSW 8 119494305 splice site probably null
R7346:Slc38a8 UTSW 8 119499815 nonsense probably null
R7425:Slc38a8 UTSW 8 119485588 missense possibly damaging 0.89
R7502:Slc38a8 UTSW 8 119501081 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TACTTGGCTCAGTAACCCAGG -3'
(R):5'- TGTGCAGTGCTCATGGAAG -3'

Sequencing Primer
(F):5'- GATGCTGAGACCCTTTAAGCC -3'
(R):5'- TGCTCATGGAAGGCAAGAGATC -3'
Posted On2020-06-30