Incidental Mutation 'R8081:Adamts2'
ID629361
Institutional Source Beutler Lab
Gene Symbol Adamts2
Ensembl Gene ENSMUSG00000036545
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2
SynonymsADAM-TS2, procollagen N-proteinase, hPCPNI, a disintegrin and metalloproteinase with thrombospondin repeats
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50602084-50807573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50777177 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 522 (D522V)
Ref Sequence ENSEMBL: ENSMUSP00000040171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040523]
Predicted Effect probably damaging
Transcript: ENSMUST00000040523
AA Change: D522V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040171
Gene: ENSMUSG00000036545
AA Change: D522V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 44 52 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 211 2.6e-39 PFAM
low complexity region 214 225 N/A INTRINSIC
coiled coil region 236 260 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 1.4e-15 PFAM
Pfam:Reprolysin_4 267 464 7.1e-11 PFAM
Pfam:Reprolysin 268 471 2.4e-20 PFAM
Pfam:Reprolysin_2 285 463 9.1e-14 PFAM
Pfam:Reprolysin_3 289 420 8.7e-13 PFAM
TSP1 565 617 9.73e-17 SMART
Pfam:ADAM_spacer1 724 838 5.1e-33 PFAM
low complexity region 839 853 N/A INTRINSIC
TSP1 858 915 1.05e-3 SMART
TSP1 918 977 2.78e-3 SMART
TSP1 980 1030 4.99e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin repeats) family of proteinases that is involved in the proteolytic processing of procollagens. The encoded protein precursor is proteolytically processed to generate a mature, zinc-dependent enzyme. Mice lacking the encoded protein develop abnormal lungs, fragile skin and male sterility. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutation of this gene results in a short snout, male infertility, and thin skin that is torn by scratching or handling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Adamts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Adamts2 APN 11 50803701 missense probably benign 0.00
IGL01366:Adamts2 APN 11 50796468 missense probably damaging 1.00
IGL01412:Adamts2 APN 11 50795403 missense probably benign 0.43
IGL01443:Adamts2 APN 11 50803863 missense possibly damaging 0.54
IGL01974:Adamts2 APN 11 50776174 missense probably damaging 0.99
IGL02267:Adamts2 APN 11 50792678 missense probably benign 0.00
IGL02498:Adamts2 APN 11 50773308 missense possibly damaging 0.81
IGL02498:Adamts2 APN 11 50777196 missense probably damaging 1.00
IGL02626:Adamts2 APN 11 50776255 missense probably damaging 0.99
IGL02634:Adamts2 APN 11 50792721 nonsense probably null
IGL02643:Adamts2 APN 11 50788700 missense probably benign 0.01
IGL02836:Adamts2 APN 11 50787279 missense probably damaging 1.00
IGL03012:Adamts2 APN 11 50776269 splice site probably benign
ANU22:Adamts2 UTSW 11 50737363 missense probably benign 0.06
H8441:Adamts2 UTSW 11 50784678 missense probably damaging 1.00
R0050:Adamts2 UTSW 11 50775395 missense probably damaging 1.00
R0050:Adamts2 UTSW 11 50775395 missense probably damaging 1.00
R0240:Adamts2 UTSW 11 50775374 missense probably damaging 1.00
R0240:Adamts2 UTSW 11 50775374 missense probably damaging 1.00
R0491:Adamts2 UTSW 11 50776630 missense probably damaging 0.98
R0501:Adamts2 UTSW 11 50668145 missense probably benign 0.16
R0570:Adamts2 UTSW 11 50776136 missense probably damaging 1.00
R0588:Adamts2 UTSW 11 50776664 missense probably damaging 1.00
R0647:Adamts2 UTSW 11 50603438 missense probably damaging 1.00
R0760:Adamts2 UTSW 11 50775326 missense probably damaging 1.00
R0784:Adamts2 UTSW 11 50668003 missense probably damaging 1.00
R1163:Adamts2 UTSW 11 50779714 missense probably damaging 1.00
R1623:Adamts2 UTSW 11 50668115 missense possibly damaging 0.79
R1641:Adamts2 UTSW 11 50792785 missense probably damaging 1.00
R1779:Adamts2 UTSW 11 50756697 missense probably damaging 0.99
R2163:Adamts2 UTSW 11 50788805 missense probably benign 0.36
R2177:Adamts2 UTSW 11 50777228 missense probably damaging 0.98
R2508:Adamts2 UTSW 11 50788689 missense possibly damaging 0.82
R3721:Adamts2 UTSW 11 50773211 splice site probably benign
R4092:Adamts2 UTSW 11 50787276 missense probably damaging 0.99
R4691:Adamts2 UTSW 11 50756696 missense probably damaging 1.00
R4785:Adamts2 UTSW 11 50792722 missense probably benign 0.00
R4809:Adamts2 UTSW 11 50803690 missense probably benign 0.17
R4823:Adamts2 UTSW 11 50737187 missense probably benign 0.26
R4927:Adamts2 UTSW 11 50803812 nonsense probably null
R4976:Adamts2 UTSW 11 50737366 missense possibly damaging 0.67
R5118:Adamts2 UTSW 11 50781869 missense probably damaging 0.99
R5478:Adamts2 UTSW 11 50792651 missense possibly damaging 0.83
R5660:Adamts2 UTSW 11 50776645 missense probably damaging 1.00
R5734:Adamts2 UTSW 11 50788667 missense probably damaging 1.00
R5865:Adamts2 UTSW 11 50803954 nonsense probably null
R6079:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
R6138:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
R6257:Adamts2 UTSW 11 50775326 missense probably damaging 1.00
R6540:Adamts2 UTSW 11 50788740 missense possibly damaging 0.77
R6897:Adamts2 UTSW 11 50737164 critical splice acceptor site probably null
R7103:Adamts2 UTSW 11 50737354 missense probably damaging 0.98
R7229:Adamts2 UTSW 11 50791820 missense probably damaging 1.00
R7261:Adamts2 UTSW 11 50786597 missense possibly damaging 0.48
R7335:Adamts2 UTSW 11 50602266 missense probably benign 0.18
R7373:Adamts2 UTSW 11 50795435 missense probably benign 0.00
R7505:Adamts2 UTSW 11 50796520 missense probably benign 0.00
R7971:Adamts2 UTSW 11 50756696 missense probably damaging 1.00
R8167:Adamts2 UTSW 11 50779714 missense probably damaging 1.00
R8256:Adamts2 UTSW 11 50792756 missense probably benign 0.41
R8298:Adamts2 UTSW 11 50777131 missense possibly damaging 0.91
R8343:Adamts2 UTSW 11 50603488 missense probably damaging 1.00
R8518:Adamts2 UTSW 11 50776130 missense probably damaging 1.00
U15987:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
X0065:Adamts2 UTSW 11 50803649 nonsense probably null
Z1176:Adamts2 UTSW 11 50792708 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATAGCCACACTGCATGC -3'
(R):5'- TCCTAAGAAGGCCCCTGG -3'

Sequencing Primer
(F):5'- CCCCAGAATCAGATGGAGCTTG -3'
(R):5'- GGATCGCCTCTGCAGATACTACAG -3'
Posted On2020-06-30