Incidental Mutation 'R8081:Six6'
ID629364
Institutional Source Beutler Lab
Gene Symbol Six6
Ensembl Gene ENSMUSG00000021099
Gene Namesine oculis-related homeobox 6
SynonymsOptx2, Six9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location72939892-72944899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 72940101 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 16 (G16W)
Ref Sequence ENSEMBL: ENSMUSP00000021519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021519] [ENSMUST00000130635] [ENSMUST00000132067] [ENSMUST00000136075]
Predicted Effect probably damaging
Transcript: ENSMUST00000021519
AA Change: G16W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021519
Gene: ENSMUSG00000021099
AA Change: G16W

DomainStartEndE-ValueType
Pfam:SIX1_SD 9 123 4.3e-50 PFAM
HOX 129 190 5.5e-15 SMART
low complexity region 219 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130635
Predicted Effect probably benign
Transcript: ENSMUST00000132067
Predicted Effect probably benign
Transcript: ENSMUST00000136075
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homeobox protein that is similar to the Drosophila 'sine oculis' gene product. This gene is found in a cluster of related genes on chromosome 12 and is thought to be involved in eye development. The encoded transcription factor regulates early progenitor cell proliferation during mammalian retinogenesis and pituitary development. Mice lacking this gene exhibit abnormal development of the suprachiasmatic nucleus and circadian rhythms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display retinal and pituitary hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Six6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Six6 APN 12 72940057 start codon destroyed probably null 0.86
R1686:Six6 UTSW 12 72941677 missense probably benign
R1920:Six6 UTSW 12 72941764 missense probably damaging 0.99
R5391:Six6 UTSW 12 72941701 nonsense probably null
R5395:Six6 UTSW 12 72941701 nonsense probably null
R6879:Six6 UTSW 12 72940524 missense probably benign 0.05
R7890:Six6 UTSW 12 72940543 missense probably benign 0.08
R8077:Six6 UTSW 12 72940326 missense probably damaging 1.00
R8181:Six6 UTSW 12 72940132 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGGCTTTTCCTAGCTGAG -3'
(R):5'- GGCGTGCGATTCCTTAGTAAAC -3'

Sequencing Primer
(F):5'- GACTCTGTAACCCCCAG -3'
(R):5'- GCGTGCGATTCCTTAGTAAACTTATG -3'
Posted On2020-06-30