Incidental Mutation 'R8081:Cdhr1'
ID629373
Institutional Source Beutler Lab
Gene Symbol Cdhr1
Ensembl Gene ENSMUSG00000021803
Gene Namecadherin-related family member 1
SynonymsPcdh21, Prcad
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R8081 (G1)
Quality Score151.008
Status Not validated
Chromosome14
Chromosomal Location37077857-37098347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37094010 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 144 (V144I)
Ref Sequence ENSEMBL: ENSMUSP00000022337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022337]
Predicted Effect probably benign
Transcript: ENSMUST00000022337
AA Change: V144I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000022337
Gene: ENSMUSG00000021803
AA Change: V144I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 57 133 9.4e-7 SMART
CA 157 245 9.44e-21 SMART
CA 269 352 2.06e-12 SMART
CA 383 471 2.68e-11 SMART
CA 495 575 5.26e-19 SMART
CA 594 685 1.64e-6 SMART
transmembrane domain 703 725 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 789 799 N/A INTRINSIC
low complexity region 817 829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the cadherin superfamily of calcium-dependent cell adhesion molecules. The encoded protein is a photoreceptor-specific cadherin that plays a role in outer segment disc morphogenesis. Mutations in this gene are associated with inherited retinal dystrophies. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive degeneration of retinal photoreceptor cells and a slight reduction in light responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Cdhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Cdhr1 APN 14 37085528 missense probably benign 0.06
IGL01820:Cdhr1 APN 14 37085579 missense probably benign 0.11
IGL02469:Cdhr1 APN 14 37085600 missense possibly damaging 0.68
IGL03373:Cdhr1 APN 14 37096300 missense possibly damaging 0.89
IGL03055:Cdhr1 UTSW 14 37095097 missense probably benign 0.07
PIT4494001:Cdhr1 UTSW 14 37082856 missense probably benign 0.07
R0110:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0219:Cdhr1 UTSW 14 37079601 missense possibly damaging 0.82
R0265:Cdhr1 UTSW 14 37081376 missense probably benign 0.02
R0450:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0510:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0522:Cdhr1 UTSW 14 37094000 critical splice donor site probably null
R0788:Cdhr1 UTSW 14 37087375 critical splice donor site probably null
R0880:Cdhr1 UTSW 14 37080634 missense possibly damaging 0.53
R1209:Cdhr1 UTSW 14 37082942 splice site probably null
R1253:Cdhr1 UTSW 14 37079625 missense probably benign
R1604:Cdhr1 UTSW 14 37095093 missense probably benign 0.29
R1968:Cdhr1 UTSW 14 37079725 missense probably benign 0.00
R2064:Cdhr1 UTSW 14 37095105 missense probably benign 0.10
R2248:Cdhr1 UTSW 14 37081377 missense probably benign
R3843:Cdhr1 UTSW 14 37084927 missense probably benign 0.03
R4178:Cdhr1 UTSW 14 37082939 splice site probably null
R4205:Cdhr1 UTSW 14 37080504 missense probably benign 0.00
R4681:Cdhr1 UTSW 14 37096237 missense probably benign 0.01
R5039:Cdhr1 UTSW 14 37079643 missense probably benign 0.02
R5088:Cdhr1 UTSW 14 37089465 missense probably benign 0.08
R5383:Cdhr1 UTSW 14 37089007 missense possibly damaging 0.94
R5507:Cdhr1 UTSW 14 37082845 missense probably damaging 0.98
R5933:Cdhr1 UTSW 14 37089462 missense probably benign 0.01
R6074:Cdhr1 UTSW 14 37079643 missense probably benign 0.02
R6291:Cdhr1 UTSW 14 37089465 missense probably benign 0.31
R6449:Cdhr1 UTSW 14 37090597 missense probably benign 0.35
R6890:Cdhr1 UTSW 14 37085645 missense probably damaging 1.00
R6891:Cdhr1 UTSW 14 37097377 splice site probably null
R7653:Cdhr1 UTSW 14 37082201 missense probably benign 0.27
R7740:Cdhr1 UTSW 14 37089380 missense probably damaging 0.98
R7805:Cdhr1 UTSW 14 37081545 missense probably benign 0.00
R8147:Cdhr1 UTSW 14 37079652 missense probably benign 0.02
R8164:Cdhr1 UTSW 14 37079542 missense probably damaging 1.00
R8283:Cdhr1 UTSW 14 37082780 missense probably benign 0.00
R8343:Cdhr1 UTSW 14 37091978 missense probably benign 0.00
R8848:Cdhr1 UTSW 14 37080574 missense probably benign 0.21
R8938:Cdhr1 UTSW 14 37087448 missense probably benign 0.17
X0062:Cdhr1 UTSW 14 37079779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGGAGGAATGGAATGC -3'
(R):5'- AGGGCATTGCTCTCAGAATTC -3'

Sequencing Primer
(F):5'- AGGAATGGAATGCTCCTGTTATAG -3'
(R):5'- TGCTCTCAGAATTCATACATTGC -3'
Posted On2020-06-30