Incidental Mutation 'R8081:Cgrrf1'
ID629374
Institutional Source Beutler Lab
Gene Symbol Cgrrf1
Ensembl Gene ENSMUSG00000055128
Gene Namecell growth regulator with ring finger domain 1
Synonyms1810009H17Rik, CGR19, 1110038G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location46832125-46854193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46854011 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 331 (T331A)
Ref Sequence ENSEMBL: ENSMUSP00000070548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068532] [ENSMUST00000226861]
Predicted Effect probably benign
Transcript: ENSMUST00000068532
AA Change: T331A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000070548
Gene: ENSMUSG00000055128
AA Change: T331A

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
RING 274 308 2.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226861
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Cgrrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Cgrrf1 APN 14 46832322 missense probably damaging 0.99
IGL02507:Cgrrf1 APN 14 46853444 nonsense probably null
IGL03298:Cgrrf1 APN 14 46846321 missense probably benign 0.08
R0152:Cgrrf1 UTSW 14 46853913 missense probably damaging 1.00
R1477:Cgrrf1 UTSW 14 46853438 missense probably benign 0.12
R2020:Cgrrf1 UTSW 14 46830445 unclassified probably benign
R2107:Cgrrf1 UTSW 14 46853376 splice site probably benign
R3010:Cgrrf1 UTSW 14 46853766 missense probably benign
R3801:Cgrrf1 UTSW 14 46832363 missense probably damaging 1.00
R4296:Cgrrf1 UTSW 14 46832355 missense probably damaging 0.99
R4681:Cgrrf1 UTSW 14 46853826 missense probably benign 0.00
R4884:Cgrrf1 UTSW 14 46853455 missense possibly damaging 0.82
R6010:Cgrrf1 UTSW 14 46853701 missense probably damaging 0.99
R6299:Cgrrf1 UTSW 14 46840190 missense probably damaging 1.00
R6861:Cgrrf1 UTSW 14 46832328 missense probably damaging 1.00
R6932:Cgrrf1 UTSW 14 46853722 missense probably benign 0.09
R6986:Cgrrf1 UTSW 14 46832129 unclassified probably benign
R7132:Cgrrf1 UTSW 14 46853864 missense probably damaging 1.00
R7152:Cgrrf1 UTSW 14 46853477 nonsense probably null
R7694:Cgrrf1 UTSW 14 46853958 missense possibly damaging 0.79
R8158:Cgrrf1 UTSW 14 46853735 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCCAGAAGACAGAAGTGTGG -3'
(R):5'- GTCCAGCATTTGCCACACTG -3'

Sequencing Primer
(F):5'- CTGGCTGGGAATGACGG -3'
(R):5'- CACTGAGTGGTAAGACTTTATTTCC -3'
Posted On2020-06-30