Mutagenetix > Incidental Mutation

Incidental Mutation 'R8081:Zfpm2'

629377

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8081 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41102248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 710 (C710S)

Ref Sequence

ENSEMBL: ENSMUSP00000051335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000053467
AA Change: C710S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: C710S

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000230319
AA Change: C578S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.9%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	T	6: 83,161,331	E119V	probably damaging	Het
Adamts2	A	T	11: 50,777,177	D522V	probably damaging	Het
Agtpbp1	A	T	13: 59,528,407	L183*	probably null	Het
Arhgap10	T	C	8: 77,382,746	I403V	possibly damaging	Het
Arhgef11	T	C	3: 87,725,642	S687P	probably damaging	Het
Cdhr1	C	T	14: 37,094,010	V144I	probably benign	Het
Cdk20	A	G	13: 64,438,952	I339V	probably benign	Het
Ceacam13	A	G	7: 18,013,188	K189E	probably damaging	Het
Cep290	C	T	10: 100,558,176	Q2082*	probably null	Het
Cgrrf1	A	G	14: 46,854,011	T331A	probably benign	Het
Cntn4	G	A	6: 106,674,607	V706I	possibly damaging	Het
Csrnp2	T	C	15: 100,489,581	D2G	probably damaging	Het
Cux2	A	G	5: 121,869,456	I714T	probably benign	Het
Cx3cr1	C	T	9: 120,051,812	E175K	possibly damaging	Het
Dennd1c	G	A	17: 57,074,139	P163L	possibly damaging	Het
Dhtkd1	C	T	2: 5,924,108	E251K	probably damaging	Het
Epas1	C	T	17: 86,829,369	P787S	probably benign	Het
Epha2	T	C	4: 141,322,294	V737A	probably damaging	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Fscb	A	T	12: 64,472,028	M888K	unknown	Het
Fuk	T	A	8: 110,889,151	R515S	probably benign	Het
Gldc	ACGACC	AC	19: 30,158,587		probably null	Het
Gm14443	A	T	2: 175,170,445	C69*	probably null	Het
Gm19668	G	A	10: 77,798,586	A183V	unknown	Het
Gm49368	A	G	7: 128,127,108	R1231G	unknown	Het
Grin2c	T	C	11: 115,249,893	Y1133C	probably damaging	Het
Hist2h3b	C	A	3: 96,268,993	Y100*	probably null	Het
Hydin	T	C	8: 110,365,469	S425P	possibly damaging	Het
Ifnl3	T	C	7: 28,524,257	S173P	probably damaging	Het
Igkv4-63	A	T	6: 69,378,034	S88T	possibly damaging	Het
Klhl5	C	A	5: 65,162,925	N607K	possibly damaging	Het
Lag3	A	T	6: 124,905,447	L362*	probably null	Het
Lats2	C	A	14: 57,700,511	G174C	probably damaging	Het
Mcm6	T	C	1: 128,338,168	E622G	probably damaging	Het
Med13l	C	A	5: 118,728,268	H462Q	probably damaging	Het
Mrpl53	T	A	6: 83,109,178	F23I	probably damaging	Het
Muc5b	T	G	7: 141,864,006	I3563S	possibly damaging	Het
Myo16	A	C	8: 10,322,743	L147F	unknown	Het
Npc1l1	G	C	11: 6,217,768	Q1008E	probably benign	Het
Npy4r	A	G	14: 34,146,567	S255P	probably damaging	Het
Nup210	T	C	6: 91,076,675	N287D	probably benign	Het
Olfr1021-ps1	C	T	2: 85,863,495	P28L	probably damaging	Het
Olfr1126	G	T	2: 87,457,169	M1I	probably null	Het
Olfr530	A	T	7: 140,373,059	L184M	probably damaging	Het
Olfr536	A	T	7: 140,504,456	M1K	probably null	Het
Olfr730	T	A	14: 50,186,368	N284I	probably damaging	Het
Opn3	T	A	1: 175,665,569	H143L	probably damaging	Het
Pdcd7	C	T	9: 65,346,685	R182C	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Picalm	T	A	7: 90,191,243	L540*	probably null	Het
Ppp1r21	T	A	17: 88,558,844	I356N	probably damaging	Het
Rgs6	C	T	12: 83,047,573	Q67*	probably null	Het
Ripor2	C	A	13: 24,713,700	Q794K	probably benign	Het
Rnf216	A	T	5: 143,027,964	I702N	probably damaging	Het
Robo4	T	C	9: 37,405,640	L417P	probably damaging	Het
Samhd1	A	T	2: 157,101,438	C605*	probably null	Het
Scaper	C	T	9: 55,916,046	G22D	unknown	Het
Senp5	T	C	16: 31,965,759	T692A	probably damaging	Het
Six6	G	T	12: 72,940,101	G16W	probably damaging	Het
Slc38a8	A	T	8: 119,485,530	M358K	possibly damaging	Het
Snx2	T	C	18: 53,216,387	F407L	probably benign	Het
Srrm2	T	A	17: 23,820,245	N1954K	probably damaging	Het
Syk	A	T	13: 52,638,159	M429L	probably benign	Het
Tln2	T	A	9: 67,356,747	N537Y	probably damaging	Het
Usp29	T	A	7: 6,963,630	M824K	probably benign	Het
Utrn	A	G	10: 12,548,059		probably benign	Het
Wdr37	C	T	13: 8,835,370	D346N	probably damaging	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TTGCCCACCTCCAACAGTAG -3'
(R):5'- TGGGTGGTAGCATTCTCCTAGC -3'

Sequencing Primer
(F):5'- CACCTCCAACAGTAGTGACG -3'
(R):5'- CTCTTGAGTGGAGCTACAAGG -3'

Posted On

2020-06-30