Incidental Mutation 'R8081:Csrnp2'
ID629378
Institutional Source Beutler Lab
Gene Symbol Csrnp2
Ensembl Gene ENSMUSG00000044636
Gene Namecysteine-serine-rich nuclear protein 2
SynonymsCSRNP-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location100479570-100495488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100489581 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000052144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061457]
Predicted Effect probably damaging
Transcript: ENSMUST00000061457
AA Change: D2G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052144
Gene: ENSMUSG00000044636
AA Change: D2G

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:CSRNP_N 61 280 5e-106 PFAM
low complexity region 330 349 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CSRNP family of nuclear proteins that share conserved regions, including cysteine- and serine- rich regions, a basic domain, a transcriptional activation domain, and bind the sequence 'AGAGTG', thus have the hallmark of transcription factors. Studies in mice suggest that these genes may have redundant functions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy and display normal development, hematopoiesis and T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Csrnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Csrnp2 APN 15 100484643 missense probably benign 0.21
R0674:Csrnp2 UTSW 15 100487991 missense probably damaging 1.00
R1988:Csrnp2 UTSW 15 100489440 missense probably damaging 1.00
R3683:Csrnp2 UTSW 15 100481998 missense probably benign
R4688:Csrnp2 UTSW 15 100482360 missense probably damaging 0.97
R4846:Csrnp2 UTSW 15 100484690 missense probably damaging 1.00
R5429:Csrnp2 UTSW 15 100482054 missense probably benign
R5678:Csrnp2 UTSW 15 100481804 makesense probably null
R6056:Csrnp2 UTSW 15 100482382 missense probably benign 0.23
R6765:Csrnp2 UTSW 15 100482693 missense probably damaging 1.00
R6925:Csrnp2 UTSW 15 100481958 missense probably benign 0.03
R7513:Csrnp2 UTSW 15 100482416 missense probably benign 0.10
R7697:Csrnp2 UTSW 15 100488072 missense probably damaging 1.00
X0020:Csrnp2 UTSW 15 100484703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTCTCTCTGAGGAGTGTG -3'
(R):5'- AGAGAAGCCAGACTCAGTGC -3'

Sequencing Primer
(F):5'- CTCTCTGAGGAGTGTGGGAGTAG -3'
(R):5'- CCAGGTGTGCAGCTTGTC -3'
Posted On2020-06-30