Incidental Mutation 'R8081:Dennd1c'
ID629381
Institutional Source Beutler Lab
Gene Symbol Dennd1c
Ensembl Gene ENSMUSG00000002668
Gene NameDENN/MADD domain containing 1C
Synonyms4432409M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location57066056-57078510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57074139 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 163 (P163L)
Ref Sequence ENSEMBL: ENSMUSP00000011623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000011623
AA Change: P163L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000011623
Gene: ENSMUSG00000002668
AA Change: P163L

DomainStartEndE-ValueType
uDENN 9 89 1.18e-22 SMART
DENN 90 293 3.95e-74 SMART
low complexity region 312 318 N/A INTRINSIC
dDENN 324 391 2.39e-18 SMART
low complexity region 560 579 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1C, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Dennd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Dennd1c APN 17 57066839 missense probably damaging 0.99
IGL02729:Dennd1c APN 17 57066637 missense probably benign 0.34
IGL03185:Dennd1c APN 17 57066803 missense probably benign 0.00
R0067:Dennd1c UTSW 17 57075465 missense probably damaging 1.00
R0067:Dennd1c UTSW 17 57075465 missense probably damaging 1.00
R0288:Dennd1c UTSW 17 57076870 splice site probably null
R0380:Dennd1c UTSW 17 57073822 missense probably damaging 1.00
R0381:Dennd1c UTSW 17 57073822 missense probably damaging 1.00
R0389:Dennd1c UTSW 17 57067649 missense probably benign 0.02
R1528:Dennd1c UTSW 17 57066935 missense probably benign
R1892:Dennd1c UTSW 17 57067083 missense probably benign 0.00
R1936:Dennd1c UTSW 17 57073889 splice site probably benign
R2216:Dennd1c UTSW 17 57074492 critical splice donor site probably null
R3021:Dennd1c UTSW 17 57074180 critical splice acceptor site probably null
R3160:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R3162:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R3162:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R4133:Dennd1c UTSW 17 57076980 missense possibly damaging 0.53
R4831:Dennd1c UTSW 17 57066428 nonsense probably null
R4987:Dennd1c UTSW 17 57073852 missense probably damaging 0.98
R5417:Dennd1c UTSW 17 57066755 frame shift probably null
R5418:Dennd1c UTSW 17 57066755 frame shift probably null
R6241:Dennd1c UTSW 17 57066272 missense probably benign 0.00
R6259:Dennd1c UTSW 17 57067104 missense probably damaging 1.00
R6722:Dennd1c UTSW 17 57066802 missense probably benign
R7099:Dennd1c UTSW 17 57067915 critical splice donor site probably null
R7491:Dennd1c UTSW 17 57072379 missense probably damaging 1.00
R7595:Dennd1c UTSW 17 57071633 missense probably damaging 1.00
R8198:Dennd1c UTSW 17 57066460 missense possibly damaging 0.84
R8896:Dennd1c UTSW 17 57074512 missense probably damaging 1.00
Z1177:Dennd1c UTSW 17 57074330 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTAGCTAAGGTTTGCTGTCCC -3'
(R):5'- CAGCAACACCCACTTCTTGG -3'

Sequencing Primer
(F):5'- TAAGGTTTGCTGTCCCACCCAC -3'
(R):5'- GACCCCGGTTTTCAGGAAGATC -3'
Posted On2020-06-30