Incidental Mutation 'R8081:Epas1'
ID629382
Institutional Source Beutler Lab
Gene Symbol Epas1
Ensembl Gene ENSMUSG00000024140
Gene Nameendothelial PAS domain protein 1
SynonymsHIF-2alpha, HRF, HLF, bHLHe73, hypoxia inducible transcription factor 2alpha, HIF2A, MOP2, Hif like protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location86753907-86833410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86829369 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 787 (P787S)
Ref Sequence ENSEMBL: ENSMUSP00000024954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024954]
Predicted Effect probably benign
Transcript: ENSMUST00000024954
AA Change: P787S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024954
Gene: ENSMUSG00000024140
AA Change: P787S

DomainStartEndE-ValueType
HLH 20 75 3.98e-9 SMART
PAS 86 152 6.39e-9 SMART
PAS 232 298 6.75e-8 SMART
PAC 304 347 5.56e-9 SMART
low complexity region 464 484 N/A INTRINSIC
Pfam:HIF-1 516 548 4.9e-21 PFAM
low complexity region 725 737 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
Pfam:HIF-1a_CTAD 837 873 3.6e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor involved in the induction of genes regulated by oxygen, which is induced as oxygen levels fall. The encoded protein contains a basic-helix-loop-helix domain protein dimerization domain as well as a domain found in proteins in signal transduction pathways which respond to oxygen levels. Mutations in this gene are associated with erythrocytosis familial type 4. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for null mutations display prenatal, neonatal or postnatal lethality. For some alleles lethality is associated with vascular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Epas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Epas1 APN 17 86823729 missense probably damaging 1.00
IGL02150:Epas1 APN 17 86805289 missense probably damaging 1.00
IGL02221:Epas1 APN 17 86827847 missense possibly damaging 0.50
IGL02555:Epas1 APN 17 86829064 missense probably benign
IGL02739:Epas1 APN 17 86805282 missense probably damaging 0.98
IGL03389:Epas1 APN 17 86823703 missense probably benign 0.10
R0043:Epas1 UTSW 17 86823812 missense probably damaging 0.99
R0363:Epas1 UTSW 17 86805848 splice site probably benign
R0399:Epas1 UTSW 17 86805193 missense probably benign 0.01
R0737:Epas1 UTSW 17 86829456 missense possibly damaging 0.45
R1542:Epas1 UTSW 17 86824490 missense possibly damaging 0.67
R1662:Epas1 UTSW 17 86829027 missense probably damaging 0.99
R1885:Epas1 UTSW 17 86805295 missense probably damaging 1.00
R2197:Epas1 UTSW 17 86829043 missense probably benign 0.01
R3056:Epas1 UTSW 17 86830981 missense probably damaging 0.99
R4342:Epas1 UTSW 17 86823800 missense probably damaging 1.00
R4391:Epas1 UTSW 17 86809663 missense probably benign 0.00
R4774:Epas1 UTSW 17 86805758 missense probably damaging 1.00
R4798:Epas1 UTSW 17 86805839 missense probably benign
R4989:Epas1 UTSW 17 86809454 missense probably damaging 1.00
R5133:Epas1 UTSW 17 86809454 missense probably damaging 1.00
R5604:Epas1 UTSW 17 86805772 missense probably damaging 1.00
R5811:Epas1 UTSW 17 86823775 missense probably damaging 1.00
R5838:Epas1 UTSW 17 86823686 missense possibly damaging 0.94
R5885:Epas1 UTSW 17 86827544 missense probably damaging 1.00
R5932:Epas1 UTSW 17 86827646 missense possibly damaging 0.66
R6045:Epas1 UTSW 17 86809399 missense probably damaging 0.99
R6145:Epas1 UTSW 17 86829429 missense probably benign 0.01
R7517:Epas1 UTSW 17 86831098 missense possibly damaging 0.92
R7552:Epas1 UTSW 17 86829043 missense probably benign 0.01
R7828:Epas1 UTSW 17 86827699 missense probably benign 0.04
R8111:Epas1 UTSW 17 86818432 nonsense probably null
R8558:Epas1 UTSW 17 86809468 missense possibly damaging 0.89
Z1176:Epas1 UTSW 17 86827946 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGGTTATATCCATGCCATGAGC -3'
(R):5'- CTTGTCCAAACGCAGAGTTG -3'

Sequencing Primer
(F):5'- ATGAGCAGGATCCCGGTTCAG -3'
(R):5'- TTCCTGCAAGTGGCTGC -3'
Posted On2020-06-30