Incidental Mutation 'R8081:Ppp1r21'
ID629383
Institutional Source Beutler Lab
Gene Symbol Ppp1r21
Ensembl Gene ENSMUSG00000034709
Gene Nameprotein phosphatase 1, regulatory subunit 21
SynonymsKlraq1, 1110018J12Rik, Ccdc128
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R8081 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location88530118-88588367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88558844 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 356 (I356N)
Ref Sequence ENSEMBL: ENSMUSP00000048443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038551]
Predicted Effect probably damaging
Transcript: ENSMUST00000038551
AA Change: I356N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048443
Gene: ENSMUSG00000034709
AA Change: I356N

DomainStartEndE-ValueType
KLRAQ 11 112 8.01e-51 SMART
coiled coil region 136 211 N/A INTRINSIC
Pfam:TTKRSYEDQ 255 771 1.8e-273 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,331 E119V probably damaging Het
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in Ppp1r21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Ppp1r21 APN 17 88562102 splice site probably benign
IGL02366:Ppp1r21 APN 17 88547662 missense probably damaging 0.99
IGL02604:Ppp1r21 APN 17 88572743 missense probably benign 0.00
IGL02680:Ppp1r21 APN 17 88583862 missense probably benign 0.00
R0266:Ppp1r21 UTSW 17 88569072 splice site probably benign
R0436:Ppp1r21 UTSW 17 88565689 missense possibly damaging 0.96
R1398:Ppp1r21 UTSW 17 88542879 missense probably damaging 1.00
R1472:Ppp1r21 UTSW 17 88558605 missense probably damaging 1.00
R1599:Ppp1r21 UTSW 17 88572627 missense probably benign 0.00
R1677:Ppp1r21 UTSW 17 88550669 missense probably benign 0.04
R1760:Ppp1r21 UTSW 17 88562225 missense possibly damaging 0.78
R2571:Ppp1r21 UTSW 17 88545382 missense probably benign 0.06
R3700:Ppp1r21 UTSW 17 88582454 missense possibly damaging 0.88
R3786:Ppp1r21 UTSW 17 88577127 splice site probably null
R3959:Ppp1r21 UTSW 17 88549816 missense probably damaging 1.00
R4649:Ppp1r21 UTSW 17 88549513 missense probably benign
R4654:Ppp1r21 UTSW 17 88558799 missense probably benign 0.01
R4724:Ppp1r21 UTSW 17 88555591 nonsense probably null
R4766:Ppp1r21 UTSW 17 88572615 missense probably benign 0.00
R4933:Ppp1r21 UTSW 17 88547621 missense probably benign 0.07
R4934:Ppp1r21 UTSW 17 88545375 missense probably damaging 1.00
R4934:Ppp1r21 UTSW 17 88545376 missense probably damaging 0.98
R4992:Ppp1r21 UTSW 17 88569080 missense probably benign 0.44
R5109:Ppp1r21 UTSW 17 88558840 missense probably damaging 1.00
R5372:Ppp1r21 UTSW 17 88550675 missense probably benign 0.21
R5861:Ppp1r21 UTSW 17 88582509 missense probably damaging 1.00
R6200:Ppp1r21 UTSW 17 88569185 missense possibly damaging 0.65
R6369:Ppp1r21 UTSW 17 88582412 splice site probably null
R7060:Ppp1r21 UTSW 17 88580544 missense probably damaging 1.00
R7154:Ppp1r21 UTSW 17 88554886 missense probably damaging 0.99
R7390:Ppp1r21 UTSW 17 88549530 missense probably benign 0.26
R7470:Ppp1r21 UTSW 17 88562221 missense probably damaging 1.00
R7475:Ppp1r21 UTSW 17 88555603 missense probably benign 0.07
R7657:Ppp1r21 UTSW 17 88555682 missense probably damaging 1.00
R8021:Ppp1r21 UTSW 17 88549507 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGAGGAAGGAATGCTGCAC -3'
(R):5'- TATTGAAACCACTGCTTATGGCC -3'

Sequencing Primer
(F):5'- GAATGCTGCACTTATTCGAGAGC -3'
(R):5'- GCCTTGTGCAATGCTAACAG -3'
Posted On2020-06-30