Incidental Mutation 'R8082:Gm597'
ID 629386
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28777498 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 484 (K484N)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably benign
Transcript: ENSMUST00000059937
AA Change: K484N

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: K484N

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,142,121 probably null Het
4921524J17Rik G A 8: 85,409,839 A133V possibly damaging Het
AI314180 G A 4: 58,807,852 A1672V probably benign Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Ankrd34c C A 9: 89,728,715 K524N probably damaging Het
Bicd2 C T 13: 49,379,053 Q372* probably null Het
Cadps2 T A 6: 23,323,314 M1002L probably damaging Het
Calcrl T C 2: 84,370,442 Y86C possibly damaging Het
Ccdc141 T C 2: 77,124,244 I220V probably damaging Het
Cep152 T C 2: 125,586,393 T773A probably benign Het
Cgn A G 3: 94,763,061 F1029L probably benign Het
Cntnap5b T A 1: 100,379,216 M515K probably benign Het
Col6a6 T A 9: 105,783,930 K327* probably null Het
Cspg4 A G 9: 56,885,893 Y304C probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
E130309D02Rik T C 5: 143,311,852 R147G probably benign Het
Emilin3 A C 2: 160,908,146 V561G probably damaging Het
Fam3c T A 6: 22,343,304 D12V unknown Het
Fam83f T C 15: 80,689,918 V158A probably damaging Het
Fgfbp1 T C 5: 43,979,279 R224G probably damaging Het
Gid4 A G 11: 60,436,447 K153E probably damaging Het
Gm13178 A C 4: 144,715,327 F118C probably damaging Het
Hic2 A G 16: 17,258,699 H464R probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ilvbl C T 10: 78,584,153 R602C probably damaging Het
Izumo1r T A 9: 14,894,077 D171V unknown Het
Kel T A 6: 41,703,490 E12V possibly damaging Het
Klf15 T C 6: 90,466,484 S14P possibly damaging Het
Lars T A 18: 42,244,910 S147C probably damaging Het
Lgals1 C T 15: 78,930,101 A122V probably benign Het
Lgsn C T 1: 31,204,192 H452Y probably benign Het
Lrrc37a T A 11: 103,457,422 I2816F unknown Het
Mcoln1 T A 8: 3,507,420 I142K probably benign Het
Met G A 6: 17,492,313 R358Q probably damaging Het
Mink1 T A 11: 70,613,277 C1276S possibly damaging Het
Mrc1 T C 2: 14,248,960 M264T probably benign Het
Mtfr2 C T 10: 20,353,389 T81M probably benign Het
Myo5c G A 9: 75,275,511 A811T possibly damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Ndufs3 T C 2: 90,894,864 D213G probably damaging Het
Olfr1009 T C 2: 85,721,480 V25A probably benign Het
Olfr1014 T A 2: 85,776,700 L39I probably benign Het
Olfr202 T C 16: 59,284,387 T37A possibly damaging Het
Olfr639 T A 7: 104,012,690 E4V probably benign Het
Otog C T 7: 46,289,719 R2058C probably damaging Het
Pcdh10 A T 3: 45,381,744 K831M probably damaging Het
Polr1b A G 2: 129,115,732 D569G probably benign Het
Polr3b T C 10: 84,656,063 L362P probably damaging Het
Rims2 G T 15: 39,476,523 R871L probably benign Het
Shprh T A 10: 11,151,811 I54N probably benign Het
Sipa1l2 T C 8: 125,491,809 D263G possibly damaging Het
Slc43a1 C T 2: 84,856,900 R382C probably benign Het
Sorbs1 T C 19: 40,365,083 R193G probably benign Het
Sry T A Y: 2,662,589 Q357L unknown Het
Taar8b T A 10: 24,091,891 D135V possibly damaging Het
Tekt3 T G 11: 63,070,230 V75G probably benign Het
Tm7sf2 A G 19: 6,066,321 L198P probably damaging Het
Tuba1a C T 15: 98,950,861 V177I probably benign Het
Wdr60 T A 12: 116,213,507 probably null Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
R8514:Gm597 UTSW 1 28778505 missense probably damaging 1.00
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9042:Gm597 UTSW 1 28776956 missense possibly damaging 0.72
R9101:Gm597 UTSW 1 28776659 missense probably benign 0.04
R9106:Gm597 UTSW 1 28776894 missense probably benign 0.00
R9173:Gm597 UTSW 1 28777349 missense probably benign 0.22
R9596:Gm597 UTSW 1 28776607 missense probably benign 0.07
R9632:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AATACTCCTGCACTGCTGGG -3'
(R):5'- GGAACTTGAAAACCTTCCCATGAAG -3'

Sequencing Primer
(F):5'- TTTTCCTGGGACCAGAAAGC -3'
(R):5'- TTCCCATGAAGAGAGACATGCTG -3'
Posted On 2020-06-30